УДК 581.1
An Efficient Method for Total RNA Extraction from Peanut Seeds
© 2012 C. Huang*,**, J. F. Picimbon*,**,***, L. H. Q. Li*,**, Z. Li*,**, Q. Liu*,**, W. Liu*,**
* Key Laboratory of Crop Genetic Improvement and Biotechnology, High-Tech Research Center, Shandong Academy of Agricultural Sciences, Jinan, Shandong, P.R. China
** Key Laboratory of Crop Genetic Improvement and Biotechnology, Huanghuaihai, Ministry of Agriculture, Jinan, P.R. China
*** Functional Genomics and Proteomics of Chemical Ecology, High-Tech Research Center, Shandong Academy of Agricultural Sciences, Jinan, Shandong, P.R. China
Received February 14, 2011
Most of conventional RNA extraction methods failed to extract highly pure and integral RNA from peanut seeds because peanut seeds are extremely rich in lipids, proteins, polysaccharides, and phenolic compounds. Here, we describe a new method, named Peanut Improved Modified RNA extraction method (PIMRNAext), using SDS, Tris-saturated phenol, NaCl, and sarkosyl during the extraction process, which are particularly successful for total RNA extraction from lipid- and polysaccharide-rich materials. The proposed PIMRNAext method is simple and fast. It requires only conventional reagents and is completed within 2 h. Using PIMRNAext gives very good yields of high quality peanut RNA. This method is about ten times more efficient than conventional methods, and the RNA produced by it is compatible with further molecular biology experiments, such as RT-PCR. We propose to use the PIMRNAext method to extract RNA from peanuts and peanut-like plant species not only for RT-PCR, but also for most molecular biology techniques that need copies of pure RNA, such as microarray or cDNA library construction.

----------------------------------
1 This text was submitted by the authors in English.
-----------------------------------
Abbreviation: PIMRNAext  Peanut Improved Modified RNA extraction method.
Corresponding author: Wei Liu. Key Laboratory of Crop Genetic Improvement and Biotechnology, High-Tech Research Center, Shandong Academy of Agricultural Sciences, North of Gongye Road 202, Jinan, Shandong 250100, P.R. China. Fax: 531-8317-8156; e-mail: wheiliu@163.com
 Keywords: Arachis hypogaea  seeds  RNA extraction  PIMRNAext  pure RNA, RT-PCR

INTRODUCTION
Isolation of high purity and quantity total RNA is a basic requirement for most molecular biology investigations, such as gene expression profiling, gene expression regulation, gene function analysis, etc. However, in plant molecular biology studies, extraction of high-quality RNA is always very difficult. The problems are that plants generally contain high amounts of endogenous ribonuclease (RNase) and many secondary metabolites, such as polyphenols, polysaccharides, lignins, carbohydrates, and etheric oils that readily attach to nucleic acids [1]. Many plant-specific RNA extraction protocols have been developed to overcome these problems [27], and some even have been developed by biotechnology companies as high quality and efficiency RNA extraction kits, such as RNA prep pure Plant kit (“Tiangen”, China), RNAiso Plus (“TaKaRa”, Japan), and Transzol plant (“Transgen”, China).
It is very common that most of the commercially available RNA extraction kits are not suitable for all plant tissues because different plants have different biochemical composition. Therefore, one nucleic acid isolation method developed for grape berry or radish is not necessarily suitable for other plants, for example peanut [5]. Peanut seeds are extremely rich in tannins, lipids (linoleic acid, oleic acid, palmitic acid, triacontanol, phospholipids, etc), proteins (cysteine-, methionine-rich protein, niacin B3, etc), polysaccharides (glucose, galactose, and mannose with xylose, arabinose, and rhamnose), and various phenolic compounds (bioflavonoid resveratrol, tocopherol, sitosterol, etc), which makes total RNA extraction from this particular plant species rather difficult [6, 814]. Phenolic compounds can be irreversibly oxidized and attached to RNA. This would result in a considerable loss of RNA when the tissues are grounded for RNA extraction. At using phenolchloroform RNA extraction procedure, the presence of high amounts of phenols in the native tissue would lead to a loss of RNA or the formation of insoluble complexes through interactions between the organic substances and nucleic acids [15]. The presence of polysaccharides, in the isolated RNA sample would interfere with solubilization of RNA pellets because polysaccharides could co-precipitate with RNA to form a colloidal substance, thereby affecting RNA spectroscopic quantification and downstream enzymatic reactions [16]. In addition, even when lysis of plant tissue leads to the release of high amounts of secondary metabolites, such as phenolic terpenoids and tannins, the quality of isolated RNA is strongly altered. Finally, plant tissues also contain high RNase activity, which can easily lead to RNA degradation and hydrolysis [17]. For all of these reasons above, specific methods are eagerly required for extraction RNA from plant tissues, in particular such as peanut seeds.
Here, we report a new RNA extraction method specifically designed for peanut seeds and named PIMRNAext (Peanut Improved Modified RNA extraction protocol). In comparison with Wang et al. [6] and Ren et al. [7] methods, the originality of PIMRNAext is the usage of SDS and water- and Tris-saturated phenols with high concentration of salt to extract RNA from peanut seeds without lipid, protein, polysaccharide, and phenol contaminations. Using PIMRNAext, the quality and purity of RNA is found to be at least ten times higher than those obtained with five common RNA extraction methods or kits. Using reverse-transcription and amplification experiments with isolated RNA samples, we showed that the PIMRNAext method generates RNA highly suitable for cDNA synthesis and further application. We also showed that this method is applicable to various peanut tissues, suggesting that PIMRNAext may be extremely useful for peanut molecular biology studies.

MATERIALS AND METHODS
Plant materials. Mature seeds of the peanut (Arachis hypogaea L., cv. Lu Hua 14) as well as roots, stems, and leaves, which were collected from 21-day-old seedlings grown at 28°C under a 16-h photoperiod were used. Collected tissues were immediately frozen in liquid nitrogen and stored at 70°C until RNA extraction.
Solutions and reagents. All disposable plastic materials were treated with DEPC water and autoclaved. Glass, mortars, and pestles were treated for 4 h at 180°C. Biochemical reagents were all analytically pure.
RNA extraction buffer was as follows: 5% TrisHCl, pH 8.0, 2% EDTA, pH 8.0, 2% SDS, 24% urea, 0.05% sodium borate, 5 M NaCl, and 2% sarkosyl. The other reagents were 4 M LiCl; water saturated phenolchloroformisoamyl alcohol (PCI) 25 : 24 : 1; DNase-RNase free (deoxyribonuclease I, “TaKaRa”, D2210); RNase inhibitor (Cloned Ribonuclease Inhibitor, “TaKaRa”, D2313A); Tris-saturated phenol; 0.1% autoclaved DEPC-treated double-distilled water; 99.5% 2-mercaptoethanol (“Amresco”).
RNA extraction. In our study, a new RNA extraction method (PIMRNAext) optimized for peanut was investigated by comparison to five known RNA extraction protocols: RNA prep pure Plant kit (“Tiangen”), RNAiso Plus (“TaKaRa”), Transzol, Transzol plant (“Transgen”), and Ren’s protocol [7].
The experimental PIMRNAext protocol was as follows:
Firstly, grind 0.20.5 g of peanut seed tissue to fine powder with mortar and pestle using liquid nitrogen as a grinding medium and transfer the powder of peanut seeds into a 2-ml Eppendorf tube containing 700 µl of extraction buffer, 450 µl of Tris-saturated phenols, 350 µl of chloroform, and 100 µl of 99.5% 2-mercaptoethanol (or DTT). Vortex the mixture vigorously for 10 s. Then pour slowly ethanol into the mixture to a final concentration of 10%. Immediately centrifuge at 12 000 g at 4°C for 10 min, carefully remove the upper aqueous phase (peanut RNA) to a new Eppendorf tube, and add an equal volume of phenolchloroformisoamyl alcohol (PCI). Centrifuge at 12 000 g at 4°C for 10 min, then transfer the upper aqueous phase (peanut RNA) to a new Eppendorf tube, and add 20 units of DNase and 5 units of RNase inhibitor to remove small amount of DNA. Incubate the reaction at 37°C for 3040 min. Afterwards, add 450 µl of water saturated phenol and 450 µl of chloroform, and vortex vigorously. Centrifuge at 12 000 g at 4°C for 10 min. Subsequently, transfer the resulting upper-phase solution to a new Eppendorf tube, add 750 µl of 4 M LiCl and 375 µl of ethanol for RNA precipitation and incubate the sample at 20°C for 20 min. Centrifuge at 12 000 g at 4°C for 10 min to collect peanut RNA. Finally, wash the RNA pellet with 70% ethanol. Centrifuge at 12 000 g at 4°C for 2 min, remove ethanol, and dry the peanut RNA pellet at room temperature before to resuspend it in an 50100 µl volume of DEPC-treated water.
Assessment of RNA purity and integrity. The purity and the integrity of the isolated peanut RNA were estimated by spectroscopy and electrophoresis. RNA purity was estimated by reading the A260/A280 and A260/A230 ratios with a spectrophotometer and loading 5 ng of RNA onto a 1% denaturing agarose gel for electrophoretic separation. RNA bands were visualized under UV trans-illumination following staining with ethidium bromide and analyzed using Alpha Innotech version 1.2.01 software. The intensity of the 28S and 18S ribosomal RNA bands was determined by pixel density, and the 28S : 18S RNA ratio was used as a measure of RNA integrity.
RT-PCR and expression profile analysis of PNbZIP1. Reverse transcription and subsequent PCR were carried out as described by the kit manufacturer (PrimeScriptTM First Strand cDNA Synthesis, “TaKaRa”), using the primer pair bZIP(F) and bZIP(R) for specific amplification of the PNbZIP1 gene, which encodes for a transcription factor in the peanut genome. A pair of specific primers for amplification of peanut actin was also used as an internal control.
The sequences of the primers are as follows: bZIP(F):5’-ATGGCTTCTCCAATTAGC-3’; bZIP(R):5’-TCAATACATGAGCATGT CC-3’; actin(F): 5’- GCCCAACTAGCGAGTCGAAC -3’; actin (R): 5’- CAGAACCCAGAAGGCTCTCC -3’.
RT-PCR conditions were: 94°C for 5 min, followed by 30 cycles of 94°C for 30 s, 56°C for 1 min, 72°C for 30 s, and an extension step at 72°C for 10 min.
2 µl of the reaction products of RT-PCR were subsequently analyzed by electrophoresis on the 1.5% agarose gel, and the products were then purified and sequenced using the ABI 3730xl DNA Analyzer and Foundation Data Collection Version 3.0 software.

RESULTS AND DISCUSSION
RNA concentrations were measured for all peanut samples using five traditional RNA extraction methods, such as RNAprep pure Plant, RNAiso Plus, Transzol, Transzol plant, and Ren’s protocol. They all failed to produce high yield and high quality RNA from peanut seeds (table; fig. 1). Using the methods of RNAprep pure Plant, RNAiso Plus, or Transzol plant, the average yields of RNA isolated from peanut seed tissue were from 28 to 58 µg/g (table). RNA integrity analysis showed no distinct bands on a smeary background (fig. 1b).
Following the transzol protocol, RNA was not extracted from peanut seeds. Following Ren’s protocol [7] significantly increased the yield of RNA extraction to about 128 µg/g of peanut seed. The electrophoretic analysis showed that RNA integrity was good (fig. 1a) as compared to those mentioned above, but rather poor RNA purity was obtained (an A260/A280 ratio was only of 1.26; table), indicating the high levels of DNA and/or protein contaminations in peanut seed RNA samples prepared according to the Ren’s protocol. An elevated absorbance at 230 nm can indicate the presence of impurities, such as buffer contamination, because Tris, EDTA, and other buffer salts absorb at this wavelength. When using PIMRNAext protocol, the A260/A230 ratios were higher than in the case of other methods (values > 2.1; table) [18], indicating the high purity of RNA extracted by this method. The A260/A280 ratios of the preparations obtained with PIMRNAext method were between 1.82.0, indicating the absence of protein contaminations.
The key issue to extract suitable RNA from peanut tissues was obviously to circumvent the sample contamination of with proteins, polysaccharides, phenolics, and DNA of the plant origin. We thus modified the Ren's protocol [7] by using SDS as a major decontaminant instead of cetyltriethylammonium bromide (CTAB). Other methods, such as RNAiso Plus, RNA prep pure Plant, and Transzol used guanidine isothiocyanate. The solubility of SDSproteinpolysaccharide complexes may be decreased by increasing the salt concentration and/or decreasing the temperature of the lysis reaction. Therefore, additional modifications were made to increase precipitation of proteins, polysaccharides, and other “impurities” of RNA samples.
The four other main improvements are as follows: (1) a specific cocktail of phenols (Tris-balanced phenol (pH  7.8) was used for nucleic acid and protein separation, while water-saturated phenol (pH 4.75.5) was used for RNA and DNA separation); (2) a very high concentration of sarkosyl and salt (5 M NaCl was used to prevent precipitation of peanut polysaccharides [7]); (3) the slowly addition of anhydrous ethanol into tissue homogenate, so that RNA remained in solution, while polysaccharides formed a jelly-like precipitate [19, 20]; in the meantime, a half-volume of 4 M LiCl was used to precipitate RNA in ice-bath for only 20 min instead of precipitation overnight to avoid co-sedimentation of unwanted materials, such as DNA or protein; and (4) RNase inhibitor was used to prevent RNA degradation when the supernatant was incubated at 37°C (incubation at 37°C is suitable not only for DNase but also for RNase activity).
Another original feature of the PIMRNAext method is that, after tissue homogenization, Eppendorf tubes were used instead of separating columns to separate the different phases. Once the separating column (RNA prep pure Plant kit, “Tiangen”) was used, it always been blocked and the flow of peanut RNA sample did not go thoroughly even during centrifugation if the peanut materials were ground fine enough. Using Eppendorf tubes not only solved the problem, but could also improve profoundly the separation system.
Finally, we obtained a yield of about 165220 μg RNA/g peanut tissue not only for seeds but also for leaves, roots, and stems (table). Following electrophoresis, two sharp and very clear bands corresponding to 28S and 18S ribosomal RNA (the 28S/18S ratio ≈ 2 : 1; fig. 1f) were obtained in all peanut tissues, indicating high yield and high purity of these RNA samples (fig. 1f). Using the PIMRNAext method, the integrity of peanut RNA in all tissues was compatible with molecular biology studies, such as RT-PCR analysis. Using RT-PCR and RNA templates extracted by PIMRNAext method from peanut seeds, a 476 bp-long cDNA fragment corresponding to the bZIPs transcription factor gene PNbZIP1 (fig. 2) could be amplified. The similar results also could be provided when using RNA templates from peanut leaves, stems, and roots instead of those from peanut seeds (fig. 2). The PNbZIP1 gene was also found to be more expressed in roots and seeds than in leaves and stems.
Thus, the PIMRNAext method is proved to be particularly relevant for RNA extraction from plant materials, which is rich in polysaccharides, polyphenolics, and/or other secondary metabolites such as peanut.
Ideally, an RNA isolation protocol should be simple, fast, nontoxic, and give good yields of high quality RNA. The procedure of PIMRNAext described in this manuscript, which used conventional reagents, was completed for only about 2 h, and could be universally applied, appears to satisfy many of these requirements. It will be a potentially effective method for RNA extraction from materials of specific nature.
This work was supported by the National Science Foundation (no. 30870191), the Foundation for Young Excellent Scientists in Shandong Province (no. BS2009NY039), and the National Program on Research and the Development of Transgenic Plants (no. 2009ZX08001-010B), Shandong Province “Taishan Scholar” foundation.
 REFERENCES
1. Dong J.Z., Dunstan D.I. A Reliable Method for Extraction of RNA from Various Conifer Tissues // Plant Cell Rep. 1996. V. 7. P. 516-521.
2. Chang S., Puryear J., Caimey J. A Simple and Efficient Method for Isolating RNA from Pine Trees // Plant Mol. Biol. Rep. 1993. V. 11. P. 113-116.
3. Ainsworth C. Isolation of RNA from Floral Tissue of Rumex acetosa (Sorrel) // Plant Mol. Biol. Rep. 1994. V. 12. P. 198-203.
4. Geuna F., Hartings H., Scienza A. A New Method for Rapid Extraction of High Quality RNA from Recalcitrant Tissues of Grapevine // Plant Mol. Biol. Rep. 1998. V. 16. P. 61-67.
5. Salzman R.A., Fujita T., Zhu-Salzman K., Hasegawa P.M., Bressan R.A. An Improved Method for Plant Tissues Containing High Levels of Phenolic Compounds or Carbohydrates // Plant Mol. Biol. Rep. 1999. V. 17. P. 11-17.
6. Wang Y., Bo H., Yang C. A Method for Rapid Isolation of Total RNA from Tamarix and Populus euphratica Oliv // J. Northeast For. Univ. 2003. V. 31. P. 99-100.
7. Ren Z., Yu S., Yang Q., Pan L., Chen M., Zheng Q. An Efficient Method of Total RNA Extraction from Peanut Seeds // J. Peanut Sci. 2008. V. 37. P. 20-23.
8. Basha S.M. Resolution of Peanut Seed Proteins by High Pressure Liquid Chromatography // J. Agr. Food Sci. 1988. V. 36. P. 778-781.
9. Sheppard A.J., Rudolf T.S. Analysis of Peanuts and Peanut Products for Total Lipids, Fatty Acids and Proximates // Peanut Sci. 1991. V. 18. P. 51-54.
10. Yang G., Espelie K.E., Todd J.W., Culbreath A.K., Pittman R.N., Demski J.W. Cuticular Lipids from Wild and Cultivated Peanuts and the Relative Resistance of These Peanuts Species to Fall Armyworm and Thrips // J. Agr. Food Chem. 1993. V. 41. P. 814-818.
11. Bilgin D.B., DeLucia E.H., Clough S.J. A Robust Plant RNA Isolation Method Suitable for Affymetrix GeneChip Analysis and Quantitative Real-Time RT-PCR // Nat. Protoc. 2009. V. 4. P. 333-340.
12. Ali-Ahmad M., Basha S.M. Effect of Water Stress on Composition of Peanut Leaves // Peanut Sci. 1998. V. 25. P. 31-34.
13. Liggins J., Bluck L.J.C., Runswick C., Atkinson C., Coward W.A., Bingham S.A. Daidzein and Genistein Content of Fruits and Nuts // J. Nutr. Biochem. 2000. V. 11. P. 326-331.
14. Wang F., Zhang B., Shan L. An Improved Method for RNA Isolation from Peanut Seeds // J. Peanut Sci. 2002. V. 31. P. 24-26.
15. Xing S., Gibor A. A Method for RNA Isolation from Marine Macro-Algae // Anal. Biochem. 1988. V. 174. P. 650-657.
16. Fang G., Hammar S., Grumet R. A Quick and Inexpensive Method for Removing Polysaccharides from Plant Genomic DNA // BioTechniques. 1992. V. 13. P. 52-56.
17. Graham G.C. A Method for Extraction of Total RNA from Pinus radiata and Other Conifers // Plant Mol. Biol. Rep. 1993. V. 11. P. 32-37.
18. Azevedo H., Lino-Neto T., Tavares R.M. An Improved Method for High-Quality RNA Isolation from Needles of Adult Maritime Pine Trees // Plant Mol. Biol. Rep. 2003. V. 21. P. 333-338.
19. Lewinsohn E., Steele C.L., Croteau R. Simple Isolation of Functional RNA from Woody Stems of Gymnosperms // Plant Mol. Biol. Rep. 1994. V. 12. P. 20-25.
20. Li H., Wang X. The Difficulties in the Isolation of RNA from Plant Tissues and Their Resolving Strategies // Biotech. Inform. 1999. V. 1. P. 36-39.

FIGURE CAPTIONS

Fig. 1. Electrophoretic separation in 1.0% agarose gel of total RNA isolated from peanut seeds using different RNA extraction methods.
From left to right: a  Ren's protocol [7]; b  RNAiso Plus (“TaKaRa”); c  RNA prep pure Plant kit (“Tiangen”); d  Transzol plant (“Tiangen”); e  Transzol (“Tiangen”); f  PIMRNAext.

Fig. 2. Expression pattern analysis of PNbZIP1 gene by RT-PCR analysis using PIMRNAext extracted RNA as template.