УДК 581.1
НОВЫЙ ЭФФЕКТИВНЫЙ МЕТОД ГЕНЕТИЧЕСКОЙ ТРАНСФОРМАЦИИ КУКУРУЗЫ С ИСПОЛЬЗОВАНИЕМ АГРОБАКТЕРИАЛЬНОГО ГАЗОНА
© 2009 г. С. А. Данилова, В. В. Кузнецов, Ю. И. Долгих
Институт физиологии растений им. К.А. Тимирязева Российской академии наук, Москва
Поступила в редакцию 10.04.2008 г.

Разработан новый способ генетической трансформации кукурузы с помощью Agrobacterium tumefaciens, позволяющий использовать в качестве эксплантов как незрелые зародыши, так и эмбриогенный каллус. Метод заключается в длительном (1520 дней) культивировании тканей кукурузы (Zea mays L.) на агробактериальном газоне. При этом проявление некроза в тканях и гибель клеток отсутствует. У полученных растений показана экспрессия генов неомицинфосфотрансферазы и -глюкуронидазы. Присутствие гена nptII подтверждено ПЦР-анализом и блот-гибридизацией по Саузерну. Эффективность генетической трансформации в зависимости от использованного генотипа кукурузы и условий проведения эксперимента варьировала от 1.5 до 16%. Показано наследование введенных генов. Разработанный метод универсален для широкого круга исследованных генотипов кукурузы.

Ключевые слова: Zea mays  Agrobacterium tumefaciens  эмбриогенный каллус  незрелые зародыши  регенерация  трансформация  агробактериальный газон  трансгенные растения.

---------------------------------------
Сокращения: Км  канамицин; Цт  цефотаксим; GUS  -глюкуронидаза.
Адрес для корреспонденции: Данилова Светлана Алексеевна. 127276 Москва, Ботаническая ул., 35. Институт физиологии растений РАН. Факс: 007 (495) 977-80-16; электронная почта: svdan@yandex.ru
 ВВЕДЕНИЕ

Среди способов генетической трансформации растений наиболее эффективным и надежным считается введение чужеродных генов, опосредованное Agrobacterium. Применение агробактерий для получения трансгенных растений кукурузы пока не нашло широкого применения из-за ряда методических трудностей, а также из-за низкой частоты трансформации и снижения способности культивируемых тканей к морфогенезу после заражения агробактериями. Исследования, имеющие целью повышение эффективности переноса генов в растения кукурузы, ведутся, главным образом, в двух направлениях: увеличение вирулентности бактерий и повышение вероятности их проникновения в ткани растений [1]. В первом случае применяют супервирулентные штаммы Agrobacterium tumefaciens [2] или активируют гены вирулентности бактерии синтетическими фенольными соединениями (ацетосирингоном) или раневыми экссудатами тканей двудольных растений [35]. Во втором случае используют различные способы повреждения поверхности трансформируемых тканей, например, встряхиванием эксплантов в суспензии A. tumefaciens в присутствии силиконово-карбидных иголочек [6], обработку на вортексе [7], бомбардировку микрочастицами золота (агробаллистический метод) [8]. Поскольку взаимодействие агробактерий с эксплантами нередко приводит к гибели клеток, что препятствует распространению агробактерий по тканям растений, некоторые авторы рекомендуют проводить совместное культивирование растительных и бактериальных клеток в присутствии антиоксидантов для снятия токсического воздействия. Так, по данным Frame и соавт. [9], после добавления в среду L-цистеина в качестве антиоксиданта частота генетической трансформации увеличивалась от 0.2 до 5%.
Большинство предлагаемых методов генетической трансформации злаковых включают стадии каллусогенеза и регенерации растений. Эффективность получения трансгенных растений существенно зависит от морфогенетического потенциала трансформируемых тканей. Механические повреждения отрицательно сказываются на способности к регенерации и уменьшают, тем самым, выход трансгенных растений. Повысить частоту проникновения бактерий в экспланты растений без их повреждения можно было бы за счет увеличения продолжительности совместного культивирования агробактерий и эксплантов. Однако на растительных тканях, прошедших инкубацию в суспензии Agrobacterium, через 23 дня культивирования на среде без антибиотиков развивается инфекция, убивающая экспланты. Мы предлагаем способ продолжительного совместного культивирования клеток кукурузы и агробактерий, обеспечивающий высокую вероятность трансформации и не оказывающий негативного влияния на рост и регенерационную способность культивируемых тканей.

МЕТОДИКА

В работе использовали две линии кукурузы (Zea mays L., А188 и R91) и гибрид F1 между ними. Каллус получали из незрелых зародышей, выделенных на 1112-й день после опыления. Зерновки вычленяли из початков, стерилизовали их поверхность коммерческим отбеливателем "Белизна" (гипохлорит натрия, 79% активного хлора) в течение 20 мин и трижды промывали стерильной дистиллированной водой. Из стерильных зерновок выделяли зародыши. Для индукции и культивирования каллуса использовали среду МС [10] с 1 мг/л 2,4-Д. Через каждые 1520 дней каллус переносили на свежую среду. Регенерацию растений проводили на среде МС с добавлением 150 мг/л антибиотика цефотаксима (Цт) [11]. Для укоренения развившиеся побеги пересаживали на среду без гормонов и витаминов с половинной концентрацией солей по МС и 10 г/л сахарозы. Укоренившиеся растения-регенеранты переносили в почвенную смесь (почва, торф и песок в равных количествах). Каллус и растения выращивали при температуре 26 ± 1°С, 16-часовом фотопериоде и интенсивности освещения 23 клк.
Для трансформации использовали штамм Agrobacterium tumefaciens LBA4404 с плазмидой рBI121, содержащей ген неомицинфосфотрансферазы II (nptII), под контролем промотора агробактериального гена нопалинсинтетазы (nos), и ген -глюкуронидазы (uidA), под контролем промотора 35S вируса мозаики цветной капусты. Трансформацию проводили путем переноса эксплантов кукурузы на агробактериальный газон. Для приготовления газона выращивали культуру A. tumefaciens в жидкой LB среде [12] в течение ночи при 26°С на шейкере (150 об./мин). Для повышения вирулентности агробактерий в суспензию добавляли экстракт стерильных растений табака, который готовили из 500 мг растительной массы табака, гомогенизированной в 5 мл жидкой среды LB. Гомогенат центрифугировали и супернатант добавляли в суспензию бактерий в соотношении 1 : 3.
Суспензию агробактерий плотностью около 109 клеток/мл (0.1 мл) переносили в чашку Петри на агаризованную питательную среду для роста каллуса и равномерно распределяли по всей поверхности микробиологическим шпателем. Чашки с газоном подсушивали в ламинар-боксе в течение 1015 мин. Для трансформации инокулюмы эмбриогенного каллуса весом около 30 мг или незрелые зародыши кукурузы раскладывали на газон агробактерий и культивировали в течение 1520 дней [13].
После инфицирования экспланты высаживали на среду с антибиотиком Цт ("Hoechst Marion Roussel", Франция) в концентрации 150200 мг/л для элиминации агробактерий и стимуляции регенерации. Каллус культивировали на среде с Цт в течение 67 пассажей до полной его дифференцировки [11].
Развивающиеся регенеранты пересаживали на питательную среду, содержавшую 25 мг/л канамицина (Км) ("Serva", Германия) и 150 мг/л Цт. Частоту регенерации определяли как среднее число регенерированных растений на один эксплант. Частоту трансформации оценивали как отношение числа Км-устойчивых растений, содержащих ген nptII, к общему количеству эксплантов и выражали в процентах.
Активность -глюкуронидазы (GUS) определяли гистологическим методом [12].
Для анализа растений на наличие чужеродных генов методами ПЦР и Саузерн-гибридизации выделяли тотальную ДНК фенольным методом из листьев кукурузы [12]. Для амплификации гена nptII использовали следующие праймеры: KF  GTGGAGAGGCTATTCGGCTA и KR  CCACCATGATATTCGGCAAG. Реакционная смесь для амплификации содержала по 2 мкл дНТФ (2 мМ), по 2 мкл каждого праймера (15 пкМ/мкл) и 1мкл (5 ед. активности) Taq ДНК-полимеразы. После начальной денатурации (3 мин при 94°С) проводили ПЦР в течение 35 циклов (денатурация 1 мин при 94°С, отжиг 40 с при 62°С, синтез 1 мин при 72°С) в амплификаторе фирмы "Mjresearch" (США). Продукты амплификации разделяли электрофорезом в 1.0% агарозном геле и окрашивали бромистым этидием.
Для проведения Саузерн-гибридизации растительную ДНК после рестрикции эндонуклеазами EcoRV/PstI наносили на 0.8% агарозный гель (20 мг/дорожка) и переносили на нейлоновую мембрану для гибридизации с радиоактивным фрагментом гена nptII [14].

РЕЗУЛЬТАТЫ

Генетическая трансформация эмбриогенного каллуса

Инкубация каллуса линий А188, R91 и гибрида А188 × R91 на агробактериальном газоне не оказывала негативного влияния на рост инокулюмов; инфекция не развивалась на поверхности растущих каллусов (рис. 1). Через 15 дней каллусы переносили на среду с Цт для элиминации бактерий и регенерации. Образующиеся регенеранты пересаживали на питательную среду, содержавшую Км и Цт. Км не добавляли в среду для роста каллуса, так как ранее было показано, что антибиотик негативно влияет на способность культивируемых клеток к морфогенезу, и отбор Км-устойчивых вариантов целесообразнее проводить после регенерации побегов [5].
Чтобы убедиться, что при культивировании тканей кукурузы на газоне может осуществляться перенос генов, в каллусах после трех циклов субкультивирования на среде с Цт определяли экспрессию гена -глюкуронидазы. После проведения реакции были выявлены крупные участки, окрашенные в голубой цвет (рис. 2б).
После инкубации каллусов на бактериальном газоне частота регенерации у линии А188 и гибрида А188 × R91 несколько снижалась, но была достаточной для отбора трансгенных растений. У линии R91 регенерация была примерно такой же высокой, как и у каллусов, культивируемых на среде без бактерий. Устойчивые к Км растения удалось отобрать среди регенерантов обеих использованных линий и гибрида, причем их количество существенно возрастало, если бактерию перед высевом для образования газона активировали экстрактом растений табака (табл. 1).
Примерно у половины Км-устойчивых растений присутствие гена nptII было подтверждено результатами молекулярного анализа. Частота ПЦР-положительных регенерантов в зависимости от генотипа кукурузы варьировала от 1.5 до 7.5%. Применение экстракта табака приводило к увеличению частоты в 2–5 раз (табл. 1). Встраивание гена nptII в геном кукурузы было подтверждено Саузерн-гибридизацией (рис. 3). Процесс получения трансгенных растений от высадки каллуса на среду с антибиотиком до отбора Км-устойчивых растений занимал около 4 месяцев. В течение этого времени каллус пересаживали 6 раз. Наибольшее число Км-устойчивых растений приходилось на последние (46) пассажи (рис. 4).
С целью проверки наследования введенных генов были получены семена от самоопыления двух Км-устойчивых регенерантов. Из листьев сеянцев была выделена ДНК для проведения ПЦР-анализа. В этих же растениях была определена экспрессия гена uidA. Из 33 проростков первого початка 9 показали наличие гена nptII и только 4  экспрессию GUS. В потомстве второго растения присутствие гена nptII было показано у трети сеянцев; у половины из них GUS-реакция была положительной.

Генетическая трансформация незрелых зародышей

Во второй серии экспериментов на газон Agrobacterium высаживали незрелые зародыши кукурузы линии R91 и гибрида А188 × R91, изолированные на 1112-й день после опыления (рис. 5а). Через 20 дней на зародышах образовался каллус (рис. 5б). Хотя образование каллуса проходило на газоне агробактерий, инфицирования и некроза тканей не наблюдалось. Характер каллусогенеза почти не отличался: на стандартной среде доля зародышей, образовавших эмбриогенный каллус, составила около 81.6%, а на агробактериальном газоне  77.2%.
Сформировавшийся каллус культивировали на среде с Цт, регенерированные побеги по мере образования переносили на среду с Км и отбирали устойчивые растения. Частота трансгенных растений, у которых вставка гена nptII была подтверждена ПЦР-анализом, была примерно такой же, как и при трансформации эмбриогенного каллуса (табл. 2). Как и в первой серии экспериментов, активация агробактерий перед образованием газона экссудатом листьев табака существенно увеличивала выход трансгенных растений.

ОБСУЖДЕНИЕ

Используемая обычно для введения чужеродных генов инкубация растительных тканей в суспензионной культуре агробактерии негативно влияет на морфогенетический потенциал эксплантов, а также способствует сильному развитию бактериальной инфекции, нередко приводящей к гибели клеток растений. Использование же агробактериального газона не приводило к избыточному инфицированию и некрозу эксплантов при длительном культивировании (до 20 дней). В этом случае бактерии не угнетали ни рост и развитие каллуса, ни образование каллуса из незрелых зародышей (рис. 1 и 5). Хотя ранее нам удавалось получать трансгенные растения после инкубации эмбриогенного каллуса в суспензии агробактерии, не все генотипы восстанавливали рост и способность к морфогенезу после инкубации в бактериальной культуре [5]. При культивировании эксплантов растений на агробактериальном газоне взаимодействие бактериальных и растительных клеток происходит, видимо, менее интенсивно. Показано, что ткани некоторых видов растений могут вырабатывать соединения, обладающие бактерицидным действием. В гомогенатах проростков кукурузы обнаружено вещество, ингибирующее рост бактерий [15]. Возможно, благодаря этому, культивирование на газоне не угнетает каллусогенез и рост тканей растений. Вместе с тем, на газоне вокруг растущих инокулюмов не образовывались видимые зоны лизиса бактерий. Это указывает на отсутствие сильного бактерицидного действия. Невысокая активность заражения компенсируется продолжительностью взаимодействия растительных и бактериальных клеток (1520 дней). За это время клетки неоднократно проходят все фазы клеточного цикла, в том числе и наиболее чувствительную к трансфекции Т-ДНК S-фазу [16]. Экспрессия гена GUS в клетках каллуса показывает, что при таком взаимодействии эксплантов с агробактериальным газоном успешно осуществляется перенос генов.
Длительный контакт растительных и бактериальных клеток имеет большое значение и при трансформации незрелых зародышей. По данным Lupotto с соавт. [2] и Frame с соавт. [9], после кратковременного культивирования в суспензии Agrobacterium транзиентная экспрессия маркерного гена GUS была локализована преимущественно в клетках оси зародыша, в то время как базальная часть щитка, из которой образуется эмбриогенный каллус, не была окрашена. Вероятно, это связано с тем, что у зародышей, помещенных на питательную среду, в первую очередь, делятся клетки осевых органов, и лишь спустя несколько дней начинается процесс каллусообразования. При заражении незрелых зародышей на газоне агробактерии весь процесс каллусогенеза проходит в присутствии бактерий, и вероятность генетической трансформации существенно возрастает.
В природе однодольные растения не заражаются Agrobacterium. Считается, что специфические сигнальные молекулы, индуцирующие гены вирулентности бактерий, обладают у однодольных растений недостаточной активностью. Индукция vir-области с помощью раневых экссудатов двудольных растений или синтетических фенольных соединений повышала частоту трансформации однодольных [4, 17]. Ранее при трансформации эмбриогенного каллуса кукурузы с использованием суспензионной культуры Agrobacterium мы определили, что действие экстракта листьев табака было сильнее, чем действие ацетосирингона [5]. По-видимому, это связано с тем, что экстракт табака содержит более широкий спектр фенольных соединений и углеводов, которые могут влиять на трансфекцию генов [18, 19], по сравнению с синтетическим фенольным соединением ацетосирингоном. Поэтому в данной работе был использован экстракт табака. Как показали результаты экспериментов (табл. 1 и 2), активация бактерий существенно повышала эффективность генетической трансформации.
Проверка потомства Км-устойчивых регенерантов растений показала наследование введенных генов. Однако не все растения, несущие ген nptII, продемонстрировали экспрессию GUS. Пока трудно сказать, является ли это следствием замолкания или потери гена uidA. Вопрос о характере наследования и экспрессии трансгенов требует более детального исследования.
Предложенный метод генетической трансформации эмбриогенного каллуса и незрелых зародышей кукурузы на агробактериальном газоне обеспечивает довольно высокую эффективность введения чужеродных генов. Выход трансгенных растений сопоставим с лучшими результатами, полученными после опосредованной Agrobacterium трансформации кукурузы [7, 9, 20]. Особенно эффективен разработанный нами метод по отношению к линиям и гибридам кукурузы с повышенной чувствительностью к токсическому действию Agrobacterium и операциям, связанным с проведением трансформации.
Работа частично финансирована грантом Президента Российской Федерации по поддержке ведущих научных школ (НШ-915.2008.4).
 СПИСОК ЛИТЕРАТУРЫ
1. Данилова С.А. Методы генетической трансформации зерновых культур // Физиология растений. 2007. Т. 54. С. 645-658.
2. Lupotto E., Reali A., Passera S., Chan M.T. Maize Elite Inbred Lines Are Susceptible to Agrobacterium tumefaciens-Mediated Transformation // Maydica. 1999. V. 44. P. 211–218.
3. Schafer W., Gorz A., Kahl G. T-DNA Integration and Expression in a Monocot Crop Plant after Induction of Agrobacterium // Nature. 1987. V. 327. P. 529-532.
4.  Захарченко Н.С., Каляева М.А., Бурьянов Я.И. Индуцирование процессинга агробактериальной Т-ДНК экссудатами однодольных растений // Физиология растений. 1999. T. 46. C. 282-291.
5. Данилова С.А., Долгих Ю.И. Условия, необходимые для эффективной агробактериальной (Agrobacterium tumefaciens) трансформации эмбриогенного каллуса кукурузы // Физиология растений. 2005. Т. 52. С. 600-607.
6. Singh N., Chawla H.S. Use of SiliconCarbide Fibers for Agrobacterium-Mediated Transformation in Wheat // Curr. Sci. 1999. V. 76. P. 1483-1485.
7. Ishida Y., Saito H., Ohta S., Hiei Y., Komari T., Kumashiro T. High Efficiency Transformation of Maize (Zea mays L.) Mediated by Agrobacterium tumefaciens // Nat. Biotech. 1996. V. 14. P. 745-750.
8. Hansen G., Chilton M.D. Agrolistic Transformation of Plant Cell: Integration of T-Strans Generated in Planta // Proc. Natl. Acad. Sci. USA. 1996. V. 93. P. 14 978-14 983.
9. Frame B.R., Shou H., Chikwamba R., Zhang Z., Xiang C., Fonger T., Pegg S.-E., Li B., Nettleton D., Pei P., Wang K. Agrobacterium-Mediated Transformation of Maize Embryos Using a Standard Binary Vector System // Plant Physiol. 2002. V. 129. P. 13-22.
10.  Murashige T., Skoog F. A Revised Medium for Rapid Growth and Bioassays with Tobacco Tissue Cultures // Physiol. Plant. 1962. V. 15. P. 473-497.
11.  Данилова С.А., Долгих Ю.И. Стимуляция регенерации растений в культуре тканей кукурузы под действием антибиотика цефотаксима // Физиология растений. 2004. Т. 51. С. 621-625.
12.  Draper J., Scott R., Armitage P., Walden R. Plant Genetic Transformation and Gene Expression: A Laboratory Manual. Oxford: Blackwell Sci., 1988. 408 p.
13.  Dанилова С.А., Долгих Ю.И. Способ получения трансформированной кукурузы in vitro: Патент №2196421 (РФ) // Б.И. 2003. № 2.
14.  Maniatis T., Fritsch E., Sambrook J. Molecular Cloning: A Laboratory Manual. Cold Springer Harbor: Cold Springer Harbor Lab., 1982. 545 p.
15.  Sahi S.V., Chilton M.D., Chilton W.S. Corn Metabolites Affect Growth and Virulence of Agrobacterium tumefaciens // Proc. Natl. Acad. Sci. USA. 1990. V. 87. P. 3879-3883.
16.  Villemont E., Dubois F., Sangwan R.S., Vasseur G., Bourgeois Y., Sangwan-Norree B.S. Role of Host Cell Cycle in the Agrobacterium-Mediated Genetic Transformation of Petunia: Evidence of an S-Phase Control Mechanism for T-DNA Transfer // Planta. 1997. V. 201. P. 160-172.
17.  Stachel S.E., Messens E., van Montagu M., Zambryski P. Identification of the Signal Molecules Produced by Wounded Plant Cells That Activate T-DNA Transfer in Agrobacterium tumefaciens // Nature. 1985. V. 318. P. 624-629.
18.  Bolton G.W., Nester E.W., Gordon M.P. Plant Phenolic Compounds Induce Expression of the Agrobacterium tumefaciens Loci Needed for Virulence // Science. 1986. V. 232. P. 983-985.
19.  Ankenbauer R.G., Nester E.W. Sugar-Mediated Induction of Agrobacterium tumefaciens Virulence Genes: Structural Specificity and Activities of Monosaccharides // J. Bacteriol. 1990. V. 172. P. 6442-6446.
20.  Zhao Z., Gu W., Cai T., Taglian L., Hondred D., Bond D., Schroeder S., Rudert M., Pierce D. High Throughput Genetic Transformation Mediated by Agrobacterium tumefaciens in Maize // Mol. Breed. 2002. V. 8. P. 323-333.

  Трансформация эмбриогенного каллуса кукурузы путем культивирования на газоне

A. tumefaciens

Таблица 1.

Генотип

Вариант

 

Число каллусов

 

Среднее число побегов, полученных от одного каллуса

 

Число Км-устойчивых растений

 

Число ПЦР-положительных растений на наличие nptII гена

Частота трансформации, %

 

 

А188

 

без трансформации

 

100

2.4 ± 0.2

0

0

-

трансформация без Э.Т.

 

138

1.2 ± 0.2

6

2

1.5

трансформация + Э.Т.

 

135

1.2 ± 0.2

24

10

7.4

 

А188 × R91

без трансформации

100

3.4 ± 0.3

0

0

-

трансформация без Э.Т.

 

124

2.8 ± 0.2

16

7

5.6

трансформация + Э.Т.

 

104

2.8 ± 0.3

21

9

8.6

 

R91

без трансформации

 

100

5.4 ± 0.5

0

0

-

трансформация без Э.Т.

 

129

5.1 ± 0.3

39

10

7.7

трансформация + Э.Т.

 

135

5.0 ± 0.2

63

22

16.2

 

Примечание. Э.Т. - экстракт табака.

 

Таблица 2.

Трансформация незрелых зародышей кукурузы путем культивирования на газоне

A. tumefaciens

Генотип

 

Вариант

 

Число незрелых зародышей

 

Среднее число побегов, полученных от одного зародыша

 

Число

Км-устойчивых растений

Число ПЦР положительных растений на наличие nptII гена

 

Частота трансформации, %

 

А188 × R91

трансформация без Э.Т.

 

112

 

2.5 ± 0.2

 

12

 

5

 

4.46

 

трансформация + Э.Т.

 

104

1.9 ± 0.3

18

7

6.73

R91

трансформация без Э.Т.

 

 

116

 

3.5 ± 0.2

 

18

 

9

 

7.76

 

трансформация + Э.Т.

 

112

3.1 ± 0.4

35

16

14.29

 

Примечание. Э.Т. - экстракт табака.

 

 


 ПОДПИСИ К РИСУНКАМ

Рис. 1. Культивирование эмбриогенного каллуса кукурузы на агробактериальном газоне в течение 2 (а) или 10 (б) дней.

Рис. 2. Экспрессия β-глюкуронидазы (GUS) в эмбриогенном каллусе кукурузы после трансформации на агробактериальном газоне.
а – контроль, б – после трансформации.

Рис. 3. Результаты Саузерн-анализа.
Геномная ДНК из растений кукурузы была обработана рестриктазами EcoRV и PstI. 15 мкг ДНК было нанесено на каждую дорожку 1% агарозного геля. После электрофореза ДНК была перенесена на нейлоновую мембрану и гибридизована с высокомеченным α-32P-фрагментом nptII гена. ДНК была выделена из нетрансформированных (1) и трансформированных растений кукурузы (2, 4, 5), а также из табака, трансгенность которого была доказана ранее (3). Размер фрагмента ДНК, с которым гибридизовалась радиоактивная проба, был равен 823 п.н. М – маркер.

Рис. 4. Процент трансгенных растений линии R91 среди регенерантов кукурузы, полученных из трансформированного каллуса на агробактериальном газоне в течение всего периода (6 пассажей) дифференциации.

Рис. 5. Культивирование незрелых зародышей кукурузы на агробактериальном газоне. а  через 1 день; б – через 20 дней.