К 581.1:577.214.625:578.853
ПОЛУЧЕНИЕ ТРАНСГЕННЫХ РАСТЕНИЙ ТАБАКА,
ЭКСПРЕССИРУЮЩИХ КОНСЕРВАТИВНЫЕ УЧАСТКИ ГЕНА AINTEGUMENTA
В АНТИСМЫСЛОВОЙ ОРИЕНТАЦИИ
© 2012 г. Б. Р. Кулуев, А. В. Князев, Я. П. Лебедев, Б. Н. Постригань, А. В. Чемерис
Учреждение Российской академии наук Институт биохимии и генетики
Уфимского научного центра РАН, Уфа
Поступила в редакцию 01.04.2011 г.
Ген AINTEGUMENTA кодирует транскрипционный фактор, принимающий участие в регуляции роста и развития как генеративных, так и вегетативных органов растений. Нами были амплифицированы и клонированы в антисмысловой ориентации два консервативных участка этого гена из арабидопсиса, рапса, табака и тополя. При помощи полученных генно-инженерных конструкций были созданы трансгенные растения табака с пониженным уровнем экспрессии гена AINTEGUMENTA. Более половины полученных трансгенных растений табака характеризовалось уменьшением размеров листьев, стеблей и цветков, при этом их форма и симметрия не изменялись. Трансгенные растения прекращали свой рост раньше контрольных, зацветали позже и отличались уменьшением количества цветков. Было показано, что основной причиной уменьшения органов у трансгенных растений явилось сокращение количества клеток, приходящихся на один орган, при этом размеры отдельных клеток оставались неизменными. Полученные нами генно-инженерные конструкции могут быть использованы для создания трансгенных растений различных видов с уменьшенными размерами органов.
Ключевые слова: Nicotiana tabacum  трансгенные растения  AINTEGUMENTA  транскрипционный фактор  посттранскрипционный сайленсинг  промотор вируса мозаики георгина  регуляция роста  величина органов
–––––––––––––––––––––––––––
Адрес для корреспонденции: Кулуев Булат Разяпович. 450054 Уфа, Проспект Октября, 71. Институт биохимии и генетики УНЦ РАН. Электронная почта: Kuluev@bk.ru
ВВЕДЕНИЕ
Несмотря на то, что величина органов растений сильно зависит от условий внешней среды, все же определяющее значение имеют особенности генотипа того или иного вида. Размеры органов растений контролируются двумя основными механизмами, а именно регуляцией клеточного деления и клеточного растяжения. Во время первой, так называемой пролиферативной фазы развития органа, происходит деление клеток и накопление цитоплазматической массы [1]. Затем процессы деления постепенно сменяются процессами растяжения, когда клетки начинают увеличиваться в размерах и происходит интенсивное поглощение воды центральной вакуолей. Очень часто процессы растяжения клеток сопряжены с эндоредупликацией, что также приводит к дальнейшему существенному увеличению размера органов [2]. Растяжение клеток регулируется, например, такими генами, как AtEXP10, AtGRF1, ARL, BPEp [3, 4]. Клеточная пролиферация также находится под жестким генетическим контролем, что было впервые показано на модельном объекте Arabidopsis thaliana при помощи экспериментов с повышением и подавлением уровня экспрессии исследуемых генов [1]. В регуляции клеточного деления участвуют гены AINTEGUMENTA (ANT), ARGOS [5], СYCLIND3;1 [6], AN3/GIF1 [7], WUSCHEL, CLAVATA3 [8] и многие другие. Ген AINTEGUMENTA является одним из ключевых генов, контролирующих клеточную пролиферацию. Кодируемый им полипептид относится к транскрипционным факторам семейства АР2/ЕRF [9]. ANT содержит 2 копии ДНК-связывающего АР2-домена [9] и, видимо, контролирует экспрессию различных генов-регуляторов роста и развития, большинство из которых пока остаются неизвестными. Одним из генов-мишеней ANT является ген СYCLIND3;1, участвующий в контроле S-периода митотического цикла [10]. Однако ANT не только стимулирует клеточные деления, но также поддерживает меристематическую компетентность клеток апикальной и латеральных меристем [10], что говорит о наличии у него и других ДНК-мишеней. ANT локализован в ядре, он активирует транскрипцию при помощи N-терминального конца, при этом с ДНК связываются оба АР2-домена одновременно [11].
Транскрипция гена ANT регулируется белком ARGOS, экспрессия которого, в свою очередь, индуцируется фитогормоном ауксином [5]. Негативная регуляция экспрессии ANT на уровне трансляции осуществляется механизмом посттранскрипционного сайленсинга посредством miRNA172 [12]. Наибольший уровень экспрессии ANT обнаруживается в клетках примордиев листа, цветка и в апикальной меристеме [13]. Белковый продукт гена ANT является одним из самых ранних маркеров начала роста новых латеральных органов, поэтому считается, что ANT играет ключевую роль при закладке примордиев органов растений [13]. Даже в полностью дифференцированных органах эктопическая экспрессия ANT приводит к каллусообразованию, появлению добавочных корней и побегов [10].
Сверхэкспрессия ANT в арабидопсисе, в первую очередь, вызывает увеличение размеров цветка благодаря активации клеточных делений в чашелистиках и растяжению клеток в лепестках, тычинках и плодолистиках [14]. Кроме того, в последующих исследованиях было показано, что трансгенные растения, экспрессирующие ген ANT под контролем 35S промотора, характеризуются более быстрым развитием и большими размерами не только генеративных, но и вегетативных органов [10]. Причем эти данные были получены не только на трансгенном A. thaliana, но и на Nicotiana tabacum [10], относящимся к другому семейству, что говорит об определенной универсальности гена ANT, а также свидетельствует о его консервативности. Мутанты арабидопсиса ant отличались более медленным развитием и меньшими размерами всех органов цветка по сравнению с растениями дикого типа [14]. В семязачатках этих растений отсутствовали интегументы и функциональные зародышевые мешки, что было основной причиной стерильности этих растений. Также наблюдалось заметное ослабление клеточных делений и уменьшение количества меристематических клеток в примордиях цветков, что приводило к уменьшению количества цветков [14]. Экспрессия гомологов и ортологов гена ANT была обнаружена и исследована у N. tabacum [15], Aegilops crassa [16] и Gnetum parvifolium [17], что говорит о том, что этот ген универсален для всех высших растений.
Представляется необходимым как поиск гомологов гена ANT в хозяйственно важных растениях, так и исследование экспрессии этого гена в гетерологичной среде в связи с возможностью получения новых теоретических данных, а также практического применения полученных знаний. Предполагается, что увеличивая уровень экспрессии гена ANT и его гомологов можно получить растения с увеличенными размерами органов. Создание трансгенных древесных растений с фрагментом гена ANT в антисмысловой ориентации теоретически может стать новым способом ускоренного получения популярных “бонсай”, на выращивание которых в настоящее время тратится значительное время и много усилий. Ранее нами был выделен полноразмерный ген AINTEGUMENTA из Brassica napus и получены трансгенные растения табака с повышенным уровнем экспрессии этого гена [18]. Было обнаружено увеличение размеров вегетативных органов у некоторых трансгенных растений табака, экспрессирующих ген ANT рапса.
В настоящей работе описываются исследования, в ходе которых выделяли и изучали два консервативных участка гена ANT из арабидопсиса, рапса, табака и тополя. Эти участки ДНК были амплифицированы и клонированы в бинарных векторах в антисмысловой ориентации. Полученные генно-инженерные конструкции были проверены на трансгенных растениях табака. Предполагалось, что часть трансгенных растений будет отличаться существенным замедлением развития и уменьшением размера как вегетативных, так и генеративных органов. Наиболее эффективные генно-инженерные конструкции планируется применить в будущем для создания декоративных древесных растений с уменьшенными органами.

МАТЕРИАЛЫ И МЕТОДЫ
Бактериальные клетки, штаммы, плазмиды, генно-инженерные манипуляции, последовательности олигонуклеотидных праймеров. В работе использованы бактерии Escherichia coli штамма XL1-Blue и Agrobacterium tumefaciens штамма AGL0. Из плазмид использовали Т-векторы pKRX и pAL-TA, бинарные векторы pCambia 2301 с геном устойчивости к канамицину, pCambia 1301 и pCambia 1305.1 с геном устойчивости к гигромицину (“CAMBIA”, Австралия). Тотальную ДНК арабидопсиса, рапса, тополя и табака выделяли методом солевой экстракции [19]. Выделенную таким образом ДНК растений очищали при помощи набора для очистки ДНК фирмы “Цитокин” (Россия) и использовали в качестве матрицы при проведении ПЦР. Плазмидную ДНК выделяли методом щелочного лизиса бактериальных колоний при помощи набора фирмы “Цитокин”. Расщепление ДНК проводили при помощи различных эндонуклеаз рестрикции в буферах, рекомендованных фирмами-поставщиками (“Сибэнзим”, Россия; “Fermentas”, Литва). Лигирование осуществляли при помощи Т4 ДНК-лигазы (“Силекс”, Россия). Качество и количество выделенных препаратов определяли аналитическим электрофорезом в 1% агарозном геле. Агарозный гель-электрофорез проводили в приборах модели Sub-Cell GT WIDE MINI (“Bio-Rad”, США). Элюцию фрагментов ДНК проводили из легкоплавкой агарозы или при помощи набора для очистки ДНК (“Цитокин”). Для ПЦР использовали амплификаторы производства компании “ДНК-технология” (Россия). Для амплификации первого консервативного участка гена ANT использовали подобранные нами универсальные праймеры ANTReg1F TGTTCATAGGAAATCTATTGATAC и ANTReg1R TTGCCTTCCTTTTCTACTCTGACC, при этом размер этого участка с интронами для различных растений составляет около 230 п.н. Второй консервативный участок выделили при помощи праймеров ANTReg2F GAGAATTATCAGAAAGAGATTG и ANTReg2R GTTACTCCTCTATAGATTGAAG, он не содержит интронов и его размер составляет около 120 п.н. Для выделения участка гена ANT рапса размером 314 п.н. использовали праймеры ANTRapF ATGGAGTCTTTTTGTGATAATG и ANTantiR GAGTGAGAAGATCTGTTGAG. Для получения ампликонов консервативных участков гена ANT с “тупыми” концами и для “затупления” липких концов после рестрикции использовали Т4-ДНК-полимеразу (“Сибэнзим”). При конструировании вектора pCambia 1301 и клонирования в нем различных генов использовали праймеры 35SCambF: AGAGGACCTAACAGAACTCG и 1301R TGCTCTAGCATTCGCCATTC, при этом размер целевого продукта реакции составляет 720 п.н. Для ПЦР 35S промотора использовали праймеры 35SCambF и 35SCambR: CGTGTTCTCTCCAAATGAAA. Для поиска клонов в бинарном векторе pCambia 2301 с промотором вируса мозаики георгина использовали праймеры DMVF ATCAACGGAGAAACAAAGAT и polyAR: GCATGCCTGCAGGTCACTGG. Для ПЦР промотора вируса мозаики георгина использовали праймеры DMVF и DMVR: ATGGGTTACTACTCACACAT. Секвенирование проводили на автоматическом секвенаторе ABI PRISM 310 Genetic Analyzer (“Applied Biosystems”, США). Электропорацию компетентных клеток A. tumefaciens проводили при помощи электропоратора фирмы “Bio-Rad” модели Micropulser. Поиск гомологичных генов осуществляли при помощи программ MegAlign пакета Lasergene (“DNASTAR”, США) и программы MegaBlast доступной через сайт http://www.ncbi.nlm.nih.gov. Олигонуклеотидные праймеры подбирали с использованием программы PrimerSelect пакета Lasergene (“DNASTAR”).
Получение трансгенных растений табака и условия их выращивания. Трансгенные формы табака (Nicotiana tabacum L., Petit Havana SR-1) получали методом агробактериальной трансформации листовых дисков [20], для получения которых использовали листья растений 3-месячного возраста. Первичные трансгенные Т0-побеги отбирали на селективной среде (соли среды МС с добавлением 1 мг/л 6-БАП, 0.1 мг/л НУК), содержащей 25 мг/л гигромицина или 100 мг/л канамицина. Качественную оценку активности репортерного гена GUS в листьях Т0-побегов определяли гистохимически, используя метод Jefferson [21]. Образцы ткани листьев инкубировали в течение ночи при 37°C в 0.1% растворе X-Gluc (натриевая соль 5-бром-4-хлор-3-индолил-бета-D-глюкуроновой кислоты, “Fermentas”), содержащем 0.1 М натриевый фосфатный буфер (pH 7.0), 10 мМ Na2-ЭДТА и 0.1% Тритон X-100. После инкубации с гистохимическим реактивом в течение ночи зеленые ткани отбеливали 70% этанолом и исследовали под стереомикроскопом на наличие синей окраски. Все полученные Т0 GUS+ побеги каждого варианта укореняли в присутствии 25 мг/л гигромицина или 100 мг/л канамицина, затем переносили в почвенную смесь, адаптировали к условиям светоплощадки, доводили до цветения и после самоопыления получали семена (Т1-потомство).
Для контроля наследования трансгенов и определения количества “вставок”, часть Т1-семян каждой полученной линии стерилизовали последовательным погружением в 70% этанол и 5% раствор гипохлорита натрия, промывали в стерильной дистиллированной воде и проращивали на среде MС с добавлением гигромицина или канамицина в климатической камере Binder (Германия). Через 3 недели производили подсчет устойчивых и неустойчивых к селективному агенту сеянцев и определяли расщепление при наследовании гена селективного маркера. Результаты обрабатывали методом χ-квадрат по стандартной методике и выделяли для дальнейшей работы линии с одной интегрированной копией трансгенов. Интеграцию собственно целевого гена в геном растений определяли с помощью ПЦР анализа.
Наблюдение за растениями поколения Т1 осуществляли, начиная от стадии появления корешков до получения семян, что занимало от 3.5 до 5 месяцев. В чашках Петри отмечали время появления корешков, семядолей, оценивали скорость роста и дружность всходов. Размеры листьев определяли только после пересадки в почву, через каждые 15 дней (через 30, 45, 60 дней и в период цветения). Для каждого варианта (линия трансгенных растений) было отобрано по 5 растений, у которых измеряли длину трех нижних листьев. Затем вычисляли среднее значение длины листа для каждого растения; длину стебля определяли только во время последнего замера, так как стебель у табака начинал активно расти только через 60 дней после акклиматизации. Отмечали время перехода к цветению, определяли длину цветка, начиная от цветоножки и заканчивая краем желобка венчика. При этом измеряли длину трех цветков с каждого растения и вычисляли среднее значение. Определяли площадь пяти листьев и вычисляли среднее значение. Кроме того, определяли массу надземной части растения в период цветения. Измерения корневой системы не проводили.
Для изучения влияния уменьшенного уровня экспрессии гена ANT на размер и количество клеток проводили измерения периметра и площади клеток нижнего эпидермиса листьев одного возраста. С каждого растения брали по одному листу и снимали нижний эпидермис с трех участков: с основания листа, с середины, а также кончика листа. Измерения проводили при помощи универсального флуоресцентного микроскопа модели Axio Imager M1 с использованием оригинального программного обеспечения. Разделив общую площадь листа, на среднюю площадь клеток абаксиального эпидермиса получали числовое значение, позволяющее оценить приблизительное количество клеток эпидермиса всего листа. Отношение числа клеток к общей площади листовой поверхности давало приблизительное представление об их количестве на единицу площади. Для оценки размеров клеток мезофилла листа делали его гистологические срезы при помощи микротома-криостата МК-25. Срезы также были сделаны в трех участках листа, а размеры клеток определяли при помощи микроскопа модели Axio Imager M1. Кроме сравнительной морфологической характеристики, из растений выделяли ДНК и проводили ПЦР.
Растения трансгенных линий и контрольные растения культивировали на открытой светоплощадке при температуре 2527°С с фотопериодом 16/8 ч (свет/темнота) и освещенностью около 10 клк в вегетационных сосудах объемом 450 мл, заполненных универсальным грунтом (“Гера”, Россия). Вначале высаживали по несколько трансгенных растений в сосуд, а в дальнейшем оставляли по одному хорошо развитому растению. Полив проводили дистиллированной водой без минеральных удобрений. В экспериментах использовали здоровые растения нормального фенотипа с темно-зелеными листьями.

результаты
Поиск гомологов гена AINTEGUMENTA, определение его консервативных участков и подбор универсальных праймеров для их амплификации
Для поиска гомологов гена ANT использовали последовательность под номером NM_119937 из GenBank, относящейся к A. thaliana. Были обнаружены гомологи гена ANT, которые относятся к N. tabacum (AY461432), Vitis vinifera (XM_002285431), Populus trichocarpa (XM_002307275 и XM_002310846), B. napus (DQ211970), Ginkgo biloba (AB195245), Pinus thunbergii (AB101585), Cycas revoluta (AB195243), Oryza sativa (NM_001056001), Triticum aestivum (AB458519), Sorghum bicolor (XM_002468181) и др. Кроме того, было обнаружено множество гомологичных ANT генов внутри каждого вида, например, у тополя их оказалось как минимум четыре. Было проведено выравнивание последовательностей генов ANT различных растений, результаты которого представлены на рис. 1 в виде филогенетического древа. Как видно, по гомологии нуклеотидных последовательностей гены ANT табака, винограда и тополя сформировали первую, а арабидопсиса и рапса вторую группу. Далее расположились гены ANT голосеменных, а наименее схожими с геном ANT арабидопсиса оказались гомологичные гены у однодольных. Для поиска консервативных участков исследуемого гена были отобраны лишь представители двудольных растений. Гены ANT табака, винограда, тополя, арабидописа и рапса были выравнены, в результате чего было обнаружено два довольно протяженных консервативных участка ДНК (рис. 1). Для выделения этих двух участков гена ANT были подобраны относительно универсальные праймеры, которые, по нашему предположению, должны позволить провести успешную амплификацию целевого гена у целого ряда двудольных растений. Прямой праймер для первого участка был подобран к области 804827 п.н. гена ANT арабидопсиса, а обратный праймер к области 925948 п.н. Размер первого участка как у арабидопсиса, так и у других составил 145 п.н., однако внутри этого участка находится один интрон и с учетом этого полный его размер составляет 233 п.н. Для амплификации второго консервативного участка была выбрана область 10511169 п.н. гена ANT арабидопсиса, при этом размер ампликона должен был составить 119 п.н. Было выяснено, что этот участок ДНК не содержит интронов, поэтому при использовании для ПЦР тотальной ДНК его размер не должен измениться.

Амплификация и клонирование консервативных участков гена ANT арабидопсиса, рапса, табака и тополя в бинарных векторах pCambia 2301, pCambia 1301 и pCambia 1305.1
После этапа выделения и очистки тотальной ДНК арабидопсиса, рапса, табака и тополя приступили к амплификации консервативных участков гена ANT. В результате проделанной работы из арабидопсиса, табака и тополя были получены ампликоны первого участка с ожидаемым размером около 230 п.н. (рис. 2а). Из табака же был амплифицирован участок большего размера, а именно около 300 п.н., что, видимо, объясняется наличием более протяженного интрона (рис. 2а). Были также получены ампликоны второго участка гена ANT арабидопсиса, рапса, табака и тополя (рис. 2а и 2б), размеры которых по результатам электрофореза составили около 100 п.н. и совпали с теоретически ожидаемыми. Также был амплифицирован 5'-конец гена ANT рапса размером 314 п.н. (рис. 2в). Все полученные ампликоны были секвенированы, полученные последовательности ДНК были проверены при помощи программ MegAlign и MegaBlast. По результатам выравниваний было сделано заключение, что выделенные нами копии участков гена ANT полностью совпадают по нуклеотидной последовательности с исследуемыми участками ДНК (NM_119937, AY461432, XM_002310846, DQ211970), а первый участок гена ANT табака действительно содержит интрон большего размера. Все полученные ампликоны были очищены, а их концы достраивались Т4-ДНК-полимеразой. После дополнительного этапа очистки все фрагменты ДНК были готовы к ненаправленному клонированию в бинарных векторах.
В бинарном векторе pCambia 2301 нами были клонированы промотор вируса мозаики георгина и сайт полиаденилирования вируса мозаики цветной капусты. Таким образом, нами был получен модифицированный вектор, в котором можно клонировать любой целевой ген по сайтам рестрикции BamHI и XbaI, где их экспрессия будет находиться под контролем сильного промотора вируса мозаики георгина [22]. Затем бинарный вектор pCambia 2301 был расщеплен эндонуклеазой рестрикции XbaI, липкие концы достраивались Т4-ДНК-полимеразой. Это было сделано для того, чтобы ненаправленно клонировать в этом векторе ампликоны с “тупыми” концами. Также в бинарный вектор pCambia 1301 по сайту SmaI была вставлена 35S кассета, состоящая из 35S промотора и 35S polyA. В этом модифицированном бинарном векторе можно клонировать различные целевые гены по сайту рестрикции SmaI. Из вектора pCambia 1305.1 по сайтам рестрикции NcoI и PmlI был выщеплен ген GUS, а липкие концы были достроены Т4-ДНК-полимеразой. В этом видоизмененном векторе также можно клонировать различные целевые гены по “тупым” концам. Таким образом, нами были модифицированы три бинарных вектора pCambia, в которых были клонированы в антисмысловой ориентации ампликоны двух консервативных участков гена ANT арабидопсиса, рапса, табака, тополя и 5'-конец гена ANT рапса размером 314 п.н. Поиск клонов с антисенс-ориентацией целевого гена осуществляли при помощи комбинации праймеров подобранных для амплификации промотора, целевого гена и сайта полиаденилирования. Целевые генно-инженерные конструкции давали специфичные ампликоны при ПЦР, например, в случае сочетания следующих пар праймеров: DMVF/ANTReg1F, DMVF/ANTReg2F, 35SF/ANTReg1F, 35SF/ANTReg2F, ANTReg1R/polyAR, ANTReg2R/polyAR и т.д. Наоборот, при сочетании переднего праймера промотора и заднего праймера целевого гена специфичные ампликоны образовывались только при сенс-ориентации целевого гена. Список некоторых полученных в ходе работы генно-инженерных конструкций приведен в табл. 1. Для дальнейших экспериментов были использованы только конструкции с консервативными участками гена ANT арабидопсиса и табака, а также 5'-конец гена ANT рапса размером 314 п.н., так как одновременное получение большого количества трансгенных растений табака представляет определенные трудности из-за больших размеров растений и очень длительного вегетационного периода. После полной проверки, полученные бинарные векторы были внедрены в клетки A. tumefaciens. Агробактериальные клоны, содержащие целевые генно-инженерные конструкции, были использованы для экспериментов по получению трансгенных растений табака и исследованию их морфофизиологических особенностей.

Получение трансгенных растений табака, экспрессирующих участки гена AINTEGUMENTA арабидопсиса и рапса в антисмысловой ориентации
Для получения трансгенных растений табака были отобраны следующие генно-инженерные конструкции: 1301/Reg1N, 1301/Reg1A, 1301/Reg2N, 2301/Reg1A, 2301/Reg1N, 2301/Reg2A, 1305.1/Reg2N, 2301/ANTB, 2301/промотор ВМГ, 1301/35S промотор, где N – это табак, A – арабидопсис, ANTB – участок гена ANT рапса. Для адаптации к условиям почвы отбирали только хорошо укоренившиеся на селективной среде растения с высокой активностью гена GUS. Все данные по количеству отобранных растений содержатся в табл. 1. Например, для варианта 1301/Reg1A было получено 44 трансгенных побега, из которых 7 укоренились на агаризованной среде МС и 6 были адаптированы к условиям почвы. Затем растения были доведены до стадии цветения, при этом все они были фертильными, самоопылялись и дали семена. Часть растений поколения Т0, как и ожидалось, заметно отставала в росте от контрольных растений с вектором без целевого гена. Однако все эксперименты по оценке скорости роста и величины органов было решено проводить только с растениями поколения Т1. Семена всех отобранных вариантов были высажены на селективную среду МС, где определяли соотношение трансгенных и нетрансгенных сеянцев. Для каждого варианта было отобрано по 37 разных линий растений, дающих расщепление 3 : 1. Из каждой чашки Петри в почву было пересажено по 10 проростков среднего размера, из которых оставляли в итоге по 5 растений, которые использовали для измерения основных морфологических параметров, начиная с 30-го дня адаптации и до периода цветения. Из трансгенных растений каждой линии выделяли ДНК и проводили ПЦР-анализ на наличие промоторной конструкции и целевого гена.

Сравнительный морфологический анализ растений табака, экспрессирующих участки гена AINTEGUMENTA арабидопсиса и табака в антисмысловой ориентации
Более половины полученных нами линий трансгенных растений, экспрессирующих участки гена ANT в антисмысловой ориентации поколения Т1, характеризовались заметным уменьшением размеров большинства органов (рис. 3). Например, в варианте 1301/Reg1N из 7 линий растений 5 отличались замедлением роста и уменьшением размеров вегетативных органов (табл. 1). В то же время, необходимо отметить, что часть линий трансгенных растений не отличалась от контрольных и не характеризовалась уменьшением размеров органов. Поэтому в дальнейших наблюдениях и измерениях использовали только линии трансгенных растений с уменьшенными размерами органов. Через 3045 дней после адаптации к условиям почвы трансгенные и контрольные растения практически еще не отличались по размеру листьев и стеблей, т.е. на ранних стадиях развития наши генно-инженерные конструкции мало влияли на рост и развитие трансгенных растений табака. Однако, начиная с 60-го дня адаптации у трансгенных растений в отличие от контрольных начиналось заметное отставание в росте листьев (табл. 2). Через некоторое время у трансгенных растений рост листьев практически прекращался, тогда как рост листьев контрольных растений продолжался вплоть до стадии цветения. В итоге в период цветения растения варианта 1301/Reg1A характеризовались уменьшением площади листьев в среднем на 83%, а по сырой массе на 77%, по сравнению с контрольными растениями (табл. 2). Растения варианта 1301/Reg1N по площади листьев были меньше на 71%, по массе на 63%, а трансгенные растения 2301/Reg3A по площади листьев на 61%, по массе на 51% меньше, чем контрольные.
Растения других вариантов также характеризовались существенным уменьшением размеров листьев и сырой массы, при этом разница составляла от 30 до 65% по сравнению с контрольными растениями. По высоте стебля трансгенные растения отличались от контрольных в меньшей степени, чем по размеру листьев, но в то же время, например, в вариантах 1301/Reg1A и 1301/Reg1N стебли были меньше на 38 и 32% соответственно, чем у контрольных растений. Наименьшие размеры цветков были характерны для растений варианта 1301/Reg1A, у которых они были в среднем на 13% меньше, чем у контрольных растений (рис. 3). У других трансгенных растений размеры цветков в меньшей степени отличались от контрольных растений, т.е. полученные нами генно-инженерные конструкции существенно влияли на развитие некоторых растений, но в целом это в меньшей степени отражалось на размерах цветков, чем на размерах листьев и стеблей.
Для определения причины уменьшения размеров органов у трансгенных растений были измерены размеры клеток нижнего эпидермиса листьев. Установили, что клетки эпидермиса трансгенных и контрольных растений практически не отличались по размеру (табл. 3). При уменьшении размеров органов у трансгенных растений наблюдали уменьшение количества клеток, но не их размеров (рис. 4). Число клеток эпидермиса в расчете на единицу площади поверхности листа у контрольных и трансгенных растений табака оказалось примерно одинаковым, тогда как при уменьшении размеров клеток этот показатель должен был бы увеличиваться. Все эти данные говорят о том, что единственной причиной уменьшения размеров органов у трансгенных растений, экспрессирующих участок гена ANT в антисмысловой ориентации, является уменьшение количества клеток в органе, но в единице площади листа их количество не уменьшалось. Были также проанализированы гистологические срезы листьев изученных растений для определения размеров клеток мезофилла (рис. 4в, 4г). Было обнаружено, что размеры клеток мезофилла также не изменялись и были примерно одинаковыми как у трансгенных, так и у контрольных растений табака. Размеры эпидермальных клеток лепестков у трансгенных растений также оставались практически неизменными (рис. 4д, 4е).
Трансгенные растения прекращали свой рост раньше контрольных. Так, большинство опытных растений переставало расти уже к 60-му дню после адаптации к условиям почвы, тогда как контрольные растения росли вплоть до стадии цветения. Трансгенные растения зацветали обычно позже контрольных и характеризовались уменьшением количества цветков до двухтрех. Часть трансгенных растений, в отличие от контрольных, росла в горизонтальном направлении, при этом часто наблюдалось искривление стебля (рис. 3ж, 3з). У некоторых трансгенных растений отсутствовали черешки на листьях, особенно это было характерно для варианта 1301/Reg1N (рис. 3з), другие были в дватри раза меньше контрольных (рис. 3л), третьи не зацветали в течение семи месяцев после адаптации к условиям почвы (рис. 3м). Наибольшее количество растений с уменьшенными размерами органов было получено при помощи генно-инженерных конструкций 1301/Reg1A и 1301/Reg1N, тогда как в варианте 1301/Reg2N из 6 трансгенных растений лишь 3 характеризовались уменьшением размеров органов.

обсуждение
Ген ANT кодирует один из важнейших транскрипционных факторов, принимающих участие в росте и развитии, обнаруживался у всех исследованных нами высших растений и, таким образом, является одним из претендентов на использование в качестве универсального гена для создания трансгенных растений с увеличенными или уменьшенными размерами органов. Влияние повышенного и пониженного уровня экспрессии этого гена на размеры органов было достаточно хорошо исследовано на модельном объекте арабидопсисе [10], однако для других видов растений исследования такого рода практически не проводились.
Предполагается, что ген ANT есть у всех растений, и, исходя из этого, мы провели поиск всех доступных в Генбанке его нуклеотидных последовательностей и их выравнивание. На основе выравнивания нуклеотидных последовательностей гена ANT различных растений было построено филогенетическое древо, которое показало, что наиболее близкими к арабидопсису являются представители двудольных растений, затем голосеменные растения и лишь после этого однодольные растения (рис. 1а). Это может объясняться как ранней дивергенцией ветвей двудольных с голосеменными и однодольных растений, так и специфическими изменениями нуклеотидной последовательности гена ANT у однодольных по сравнению с двудольными в процессе эволюции. Проведенное выравнивание позволило обнаружить два консервативных участка в гене ANT, которые нами и использовались для его РНК-сайленсинга в трансгенных растениях табака. Были подобраны относительно универсальные праймеры, которые позволяют амплифицировать эти два консервативных участка ДНК из большинства двудольных растений. Таким образом, эти праймеры могут быть использованы для анализа специфических участков гена ANT различных двудольных растений, в том числе и у тех видов, у которых нуклеотидная последовательность этого гена не определена.
Предполагалось, что экспрессия консервативных участков гена ANT в антисмысловой ориентации может быть эффективно использована для уменьшения размеров органов не только арабидопсиса, но и других видов двудольных растений. Для подтверждения этого предположения нами были получены трансгенные растения табака, экспрессирующие консервативные участки гена ANT арабидопсиса и табака в антисмысловой ориентации. Необходимо отметить, что получить трансгенные растения с уменьшенным уровнем экспрессии гена ANT оказалось довольно сложно, возможно, из-за негативного влияния недостаточного количества важного транскрипционного фактора на начальных стадиях развития трансгенного побега. Однако все полученные нами в итоге трансгенные растения были фертильны и дали семена. Более половины полученных нами трансгенных растений характеризовалось существенным уменьшением размеров всех надземных органов. Некоторые опытные растения были меньше контрольных в дватри раза, в среднем же по площади листьев мы наблюдали уменьшение на 6080%, а по сырой массе растения на 5070%. Такое же уменьшение органов наблюдалось у мутантов арабидопсиса ant-1, однако у этих растений размеры цветков уменьшались в большей степени, чем размеры листьев [10]. В полученных нами трансгенных растениях табака, наоборот, цветки уменьшались лишь на 513% по сравнению с контрольными растениями. Это может объясняться существованием альтернативных путей регуляции размеров цветков у табака, в отличие от арабидопсиса, а также сравнительно маленькими размерами цветков у табака, по сравнению с размерами листьев, что предполагает меньшие вариации в размерах при изменении количества клеток. У трансгенных растений уменьшались размеры всех органов цветка (чашелистики, лепестки, тычинки и плодолистики), однако функции мужского и женского гаметофитов, видимо, сохранялись на должном уровне, так как все опытные растения были фертильными. Длина побегов у трансгенных растений была меньше, но не столь существенно, как размеры листьев, что может объясняться тем, что ген ANT в меньшей степени участвует в регуляции роста стеблей. Это соответствует литературным данным, из которых известно, что в растениях дикого типа экспрессия гена ANT обнаруживается только в семядолях, листьях, цветках и семязачатках, поэтому, видимо, данный транскрипционный фактор участвует в регуляции роста и развития только этих органов [14]. В табаке наибольший уровень экспрессии гена ANT наблюдали в пестике и листьях [15], поэтому предполагалось, что снижение уровня экспрессии целевого гена должно приводить, в первую очередь, к уменьшению размеров именно этих органов. Действительно, у полученных нами трансгенных растений пестики были меньше, чем у контрольных растений, но размеры тычинок, лепестков и чашелистиков также пропорционально уменьшались. Известно, что сверхэкспрессия гена ANT способствует пролонгированию роста основных органов [5, 10], соответственно уменьшение уровня его экспрессии должно способствовать, наоборот, раннему прекращению роста. В самом деле, полученные нами трансгенные растения также рано прекращали свой рост, особенно это касалось листьев, тогда как стебли иногда продолжали расти вплоть до стадии цветения.
Представляет определенный интерес, какая из полученных нами генно-инженерных конструкций наиболее эффективно способствовала уменьшению размеров органов. В целом, наиболее эффективными конструкциями оказались 1301/Reg1A и 1301/Reg1N, которых объединяет наличие одного и того же бинарного вектора pCambia 1301 и первого консервативного участка гена ANT как арабидопсиса, так и табака. К сожалению, однозначно объяснить эффективность именно этих конструкций очень сложно, но скорее всего, это связано с первым консервативным участком гена ANT, так как растения с тем же вектором и вторым консервативным участком ANT не отличались столь же существенным уменьшением размеров органов.
По размеру клеток листьев полученные нами трансгенные растения не отличались от контрольных, и размеры органов уменьшались только из-за малого количества клеток в органе. Следует отметить, что размеры клеток у мутантов арабидопсиса ant-1 были больше, чем у растений дикого типа, т.е. у мутантов ant-1 в органах сильно уменьшалось количество клеток, но размеры клеток не только не уменьшались, а наоборот, увеличивались [10]. У полученных нами трансгенных растений количество клеток, приходящихся на орган, уменьшалось, но размеры клеток в основном оставались неизменными. Более позднее цветение трансгенных растений объясняется, видимо, общим негативным влиянием на рост и развитие растения уменьшенного уровня экспрессии гена ANT. Предполагаемое участие транскрипционного фактора ANT в закладке примордиев органов проявилось и в наших исследованиях в виде уменьшения количества цветков у трансгенных растений.
Итак, нами были получены генно-инженерные конструкции, которые могут быть использованы для получения различных трансгенных растений с уменьшенными размерами органов. Получены линии трансгенных растений табака с уменьшенными размерами листьев, стеблей и цветков. Планируется создание трансгенных древесных растений с уменьшенным размером ствола и листьев, для этого нами ведутся работы по получению растений осины, экспрессирующих участок гена ANT тополя в антисмысловой ориентации. К сожалению, уменьшить размеры стебля трансгенных растений нам удалось в среднем лишь на 30%, и полученные генно-инженерные конструкции едва ли могут быть применены в декоративном растениеводстве для создания карликовых деревьев. Для этого необходимо продолжить интенсивные исследования генетической регуляции роста и развития растений и вести поиск новых генов-регуляторов, как клеточной пролиферации, так и клеточного растяжения.
Работа выполнена при финансовой поддержке Федеральной целевой программы “Научные и научно-педагогические кадры инновационной России” на 20092013 годы” (государственный контракт № П1368).
СПИСОК ЛИТЕРАТУРЫ
1.Anastasiou E., Lenhard M. Control of Plant Organ Size // Plant Growth Signalling / Eds Bögre L. and Beemster G. New York: Springer-Verlag, 2008. P. 25-45.
2.Sugimoto-Shirasu K., Roberts G.R., Stacey N.J., McCann M.C., Maxwell A., Roberts K. RHL1 Is an Essential Component of the Plant DNA Topoisomerase VI Complex and Is Required for Ploidy-Dependent Cell Growth // Proc. Natl. Acad. Sci. U.S.A. 2005. V. 102. P. 18 736-18 741.
3.Cho H.T., Cosgrove D.J. Altered Expression of Expansin Modulates Leaf Growth and Pedicel Abscission in Arabidopsis thaliana // Proc. Natl. Acad. Sci. U.S.A. 2000. V. 97. P. 9783-9788.
4.Hu Y., Poh H., Chua N. The Arabidopsis ARGOS-LIKE Gene Regulates Cell Expansion during Organ Growth // Plant J. 2006. V. 47. P. 1-9.
5.Hu Y., Xie Q., Chua N. The Arabidopsis Auxin-Inducible Gene ARGOS Controls Lateral Organ Size // Plant Cell. 2003. V. 15. P. 1951-1961.
6.Dewitte W., Riou-Khamlichi C., Scofield S., Healy J.M., Jacqmard A., Kilby N.J., Murray J.A.H. Altered Cell Cycle Distribution, Hyperplasia, and Inhibited Differentiation in Arabidopsis Caused by the D-Type Cyclin CYCD3 // Plant Cell. 2003. V. 15. P. 79-92.
7.Horiguchi G., Kim G.T., Tsukaya H. The Transcription Factor AtGRF5 and the Transcription Coactivator AN3 Regulate Cell Proliferation in Leaf Primordia of Arabidopsis thaliana // Plant J. 2005. V. 43. P. 68-78.
8.Weiss J., Delgado-Benarroch L., Egea-Cortines M. Genetic Control of Floral Size and Proportions // Int. J. Dev. Biol. 2005. V. 49. P. 513-525.
9.Krizek B.A. Making Bigger Plants: Key Regulators of Final Organ Size // Curr. Opin. Plant Biol. 2009. V. 12. P. 17-22.
10.Mizukami Y., Fisher R.L. Plant Organ Size Control: AINTEGUMENTA Regulates Growth and Cell Numbers during Organogenesis // Proc. Natl. Acad. Sci. U.S.A. 2000. V. 97. P. 942-947.
11.Nole-Wilson S., Krizek B.A. DNA Binding Properties of The Arabidopsis Floral Development Protein AINTEGUMENTA // Nucleic Acids Res. 2000. V. 28. P. 4076-4082.
12.Chen X. A MicroRNA as a Translational Repressor of APETALA2 in Arabidopsis Flower Development // Science. 2004. V. 26. P. 2022-2025.
13.Nole-Wilson S., Krizek B.A. AINTEGUMENTA Contributes to Organ Polarity and Regulates Growth of Lateral Organs in Combination with YABBY Genes // Plant Physiol. 2006. V. 141. P. 977-987.
14.Krizek B.A. Ectopic Expression of AINTEGUMENTA in Arabidopsis Plants Results in Increased Growth of Floral Organs // Dev. Genet. 1999. V. 25. P. 224-236.
15.Rieu I., Bots M., Mariani C., Weterings K.A. Isolation and Expression Analysis of a Tobacco AINTEGUMENTA Ortholog (NtANTL) // Plant Cell Physiol. 2005. V. 46. P. 803-805.
16.Mizumoto K., Hatano H., Hirabayashi C., Murai K., Takumi S. Altered Expression of Wheat AINTEGUMENTA Homolog, WANT-1, in Pistil and Pistil-Like Transformed Stamen of an Alloplasmic Line with Aegilops crassa Cytoplasm // Dev. Genes Evol. 2009. V. 219. P. 175-187.
17.Yamada T., Hirayama Y., Imaichi R., Kato M. AINTEGUMENTA Homolog Expression in Gnetum (Gymnosperms) and Implications for the Evolution of Ovulate Axes in Seed Plants // Evol. Dev. 2008. V. 10. P. 280-287.
18.Кулуев Б.Р., Чемерис А.В. Амплификация и клонирование полноразмерного гена AINTEGUMENTA рапса // Аграрная Россия. 2009. Спец. вып. С. 124.
19.Aljanabi S.M., Martinez I. Universal and Rapid Salt-Extraction of High Quality Genomic DNA for PCR-Based Techniques // Nucleic Acids Res. 1997. V. 25. P. 4692-4693.
20.Gallois P., Marinho P. Leaf Disk Transformation Using Agrobacterium tumefaciens-Expression of Heterologous Genes in Tobacco // Methods in Molecular Biology. V. 49. Plant Gene Transfer and Expression Protocols / Ed. Jones H. Totowa (NJ): Humana, 1994. P. 39-48.
21.Jefferson R.A. Assaying Chimeric Genes in Plants: The GUS Gene Fusion System // Plant Mol. Biol. Rep. 1987. V. 5. P. 387-405.
22.Кулуев Б.Р., Князев А.В., Ильясова А.А., Чемерис А.В. Конститутивная экспрессия гена ARGOS в растениях табака под контролем промотора вируса мозаики георгина // Физиология растений. 2011. Т. 58. C. 443-452.

ПОДПИСИ К РИСУНКАМ
Рис. 1.Результаты сравнительного анализа последовательностей нуклеотидов гена AINTEGUMENTA различных растений.
а – филогенетическое древо сходства гена AINTEGUMENTA арабидопсиса с гомологичными генами других растений; б – первый консервативный участок гена ANT, обозначенный нами Reg1; в – второй консервативный участок гена ANT, обозначенный нами Reg2.

Рис. 2.Электрофореграммы результатов ПЦР участков гена ANT различных растений.
а – результаты амплификации консервативных участков гена ANT, где 1 – маркер с мол. м. 1001000 п.н. (“Силекс”); 2 – ампликон Reg1, арабидопсис; 3 – ампликон Reg1, рапс; 4 – ампликон Reg1, табак; 5 – ампликон Reg2, арабидопсис; 6 – ампликон Reg2, рапс; 7 – ампликон Reg2, табак; б – результаты амплификации второго консервативного участка гена ANT тополя, где 1 – маркер мол. м. 25010 000 п.н. (“Сибэнзим”), 2 – ампликон Reg1, тополь; в – результаты амплификации 5'-концевого участка гена ANT рапса размером 314 п.н., где 1 – маркер мол. м. 25010 000 п.н. (“Сибэнзим”), 2 – ампликон ANTанти, рапс.

Рис. 3.Сравнение трансгенных растений поколения Т1, экспрессирующих участок гена ANT в антисмысловой ориентации и контрольной группы, содержащей в своем геноме векторную молекулу без целевого гена.
а – контрольные растения pCambia 1305.1 через 30 дней после акклиматизации; б – контрольные растения pCambia 2301 через 30 дней после акклиматизации; в – трансгенные растения 1301/Reg1A через 30 дней после акклиматизации; г – трансгенные растения 1301/Reg1N через 30 дней после акклиматизации; д – контрольные растения pCambia 1305.1 в период цветения; е – контрольные растения pCambia 2301 в период цветения; ж – трансгенные растения 1301/Reg1A в период цветения; з – трансгенные растения 1301/Reg1N в период цветения; и – сравнение цветков контрольных растений (слева) и трансгенных растений 1301/Reg1A; к – сравнение листьев контрольных растений (слева) и трансгенных растений 1301/Reg1A; л – контрольные растения pCambia 1301 (слева) и трансгенные растения 1301/Reg1N в период цветения; м – трансгенные растения 1301/Reg1A и 1301/Reg1N (слева), не зацветавшие в течение семи месяцев вегетации, в сравнении с контрольным растением (справа).

Рис. 4.Сравнение размеров клеток листа и лепестков контрольного растения и трансгенных по целевым генам растений.
а – клетки нижнего эпидермиса контрольного растения; б – клетки нижнего эпидермиса трансгенного растения 1301/Reg3N; в – клетки мезофилла листа контрольного растения; г – клетки мезофилла листа трансгенного растения 1301/Reg1A; д – клетки эпидермиса лепестков контрольного растения; е – клетки эпидермиса лепестков трансгенного растения 1301/Reg3N.