УДК 581.1:577.214.625:578.853
КОНСТРУИРОВАНИЕ ГИБРИДНЫХ ПРОМОТОРОВ КАУЛИМОВИРУСОВ И АНАЛИЗ ИХ АКТИВНОСТИ В ТРАНСГЕННЫХ РАСТЕНИЯХ
 © 2010 г. Б. Р. Кулуев, А. В. Князев, Я. П. Лебедев, А. А. Ильясова, А. В. Чемерис
Учреждение Российской академии наук Институт биохимии и генетики Уфимского научного центра РАН, Уфа
Поступила в редакцию 30.09.2009 г.
Методами ДНК-шаффлинга, ПЦР и рестрикции(лигирования получены гибридные формы промоторов вируса мозаики цветной капусты (Brassica oleracea) (ВМЦК), вируса мозаики георгина (Dahlia pinnata) (ВМГ) и вируса кольцевой гравировки гвоздики (Dianthus caryophillus) (ВКГГ) в различных комбинациях. 12 гибридных промоторов клонировали в бинарных векторах pCambia с репортерным геном GUS и флюориметрическим методом определяли их активность в трансгенных растениях табака (Nicotiana tabacum). В качестве контроля были использованы 35S промотор, промотор ВМГ размером 442 п.н. и промоторы ВКГГ размером 371 и 501 п.н. 7 из проанализированных промоторов показали бóльшую, а 7 ( меньшую, чем 35S промотор, силу в трансгенных растениях табака. Наибольшую активность показал природный промотор ВМГ, а наименьшую ( природный промотор ВКГГ размером 501 п.н. Активность промотора ВКГГ размером 371 п.н. оказалась примерно равной силе 35S промотора.

Ключевые слова: Nicotiana tabacum ( 35S промотор ( каулимовирус ( вирус мозаики георгина ( ДНК-полимераза фага phi 29 ( ДНК-шаффлинг ( активность промотора

---------------------------------------
Сокращения: ВКГГ - вирус кольцевой гравировки гвоздики; ВМГ - вирус мозаики георгина; ВМЦК - вирус мозаики цветной капусты; GUS - β-глюкуронидаза; 4-MU - 4-метилумбеллиферил-β-глюкуронид; X-Gluc ( 5-бром-4-хлор-3-индолил-β-D-глюкуронид.
Адрес для корреспонденции: Кулуев Булат Разяпович. 450054 Уфа, Проспект Октября, 71. Институт биохимии и генетики Уфимского научного центра РАН. Факс: 8 (347) 235-60-88; электронная почта: Kuluev@bk.ru

ВВЕДЕНИЕ

Несмотря на все более широкое распространение тканеспецифичных и индуцибельных промоторов в генной инженерии растений [1, 2], конститутивные промоторы также не теряют своей значимости и довольно часто применяются как в фундаментальных исследованиях, так и в прикладных целях [3, 4]. Среди конститутивных промоторов одним из самых известных и распространенных является 35S промотор вируса мозаики цветной капусты (ВМЦК), который показал высокую эффективность и отсутствие тканеспецифичности в клетках как двудольных, так и однодольных растений [5, 6]. Однако для некоторых целей силы данного промотора оказалось недостаточно, особенно это актуально при использовании трансгенных растений в качестве продуцентов физиологически активных веществ [7]. В других же случаях, например, при сверхэкспрессии важных для регуляции роста и развития растений факторов, когда значительное накопление целевого белкового продукта может играть отрицательную роль, возникает необходимость в применении более слабых конститутивных промоторов из-за высокой вероятности летальности трансгенного растения или приобретения им стерильности [8]. Кроме того, 35S промотор во многих бинарных векторах контролирует не только экспрессию целевого гена, но часто селективного и маркерного генов. При получении трансгенных по нескольким генам растений число копий 35S промотора возрастает уже многократно, что может приводить к уменьшению уровня экспрессии, ввиду того, что с энхансерной областью данного промотора взаимодействуют одни и те же физиологически активные транскрипционные факторы, ресурс которых может быть исчерпаем. В некоторых случаях описанный выше процесс может приводить к так называемому "молчанию" трансгена. Поэтому для исследователя, работающего над созданием большого количества различных трансгенных растений, представляется важным иметь целый ряд конститутивных промоторов, отличающихся как по экспрессионной активности, так и по последовательности нуклеотидов.
Одним из путей создания новых эффективных промоторов является метод направленной молекулярной эволюции in vitro. Представляет особую важность создание гибридных форм промоторов методом ДНК-шаффлинга - высокоэффективного метода рекомбинации генетического материала, с кодированием гомологичных белков или их доменов [9], а также промоторных последовательностей [10]. Для проведения экспериментов по направленной молекулярной эволюции in vitro с использованием большинства методов необходимым условием является наличие гомологии между нуклеотидными последовательностями [9]. Одной из трудностей при проведении ДНК-шаффлинга является преимущественное восстановление родительских последовательностей, однако предложенный подход с использованием фрагментов одноцепочечной ДНК заметно повысил эффективность получения гибридных молекул [11]. Ранее нами были выделены и исследованы промоторы вируса кольцевой гравировки гвоздики (ВКГГ) размером 371 п.н. (6721(7091 в координатах генома ВКГГ, номер доступа в Генбанке X04658.1) и 501 п.н. (6721(7221 в координатах генома ВКГГ, номер доступа в Генбанке X04658.1) и вируса мозаики георгина (ВМГ) размером 442 п.н. (номер доступа EF513491) [12, 13]. Однако уровень их гомологии с 35S промотором составил не более 50% и оказался довольно низким для проведения эффективного ДНК-шаффлинга. По этой причине для подготовки промоторов к ДНК-шаффлингу было решено наработать их в одноцепочечной форме с многократно повторяющейся последовательностью промоторного участка без значительной примеси нуклеотидной последовательности плазмидного вектора. Для этого был использован метод, который заключается в применении амплификации по типу катящегося кольца с использованием ДНК полимеразы фага phi 29. Гибридные формы промоторов каулимовирусов были получены нами также с применением широко распространенных методов молекулярной биологии, таких как ПЦР, расщепление ДНК эндонуклеазами рестрикции и лигирования при помощи ДНК-лигазы. Предполагалось, что в результате экспериментов должны быть получены конститутивные промоторы, различающиеся как по нуклеотидной последовательности, так и по экспрессионной активности.

МАТЕРИАЛЫ И МЕТОДЫ

Объектами исследований были природные и гибридные промоторы полноразмерного транскрипта вируса мозаики цветной капусты (ВМЦК), вируса кольцевой гравировки гвоздики (ВКГГ) и вируса мозаики георгина (ВМГ). Растениями-хозяевами этих каулимовирусов являются Brassica oleracea - цветная капуста, Dianthus caryophillus - гвоздика садовая и Dahlia pinnata - георгин перистый соответственно.
Плазмидную ДНК выделяли методом щелочного лизиса бактериальных колоний при помощи набора фирмы "Цитокин" (Россия). Расщепление ДНК проводили при помощи различных эндонуклеаз рестрикции в буферах, рекомендованных фирмами-поставщиками ("Сибэнзим", Россия; "Fermentas", Литва). Лигирование проводили при помощи Т4 ДНК-лигазы ("Силекс", Россия). Качество и количество выделенных препаратов определяли аналитическим электрофорезом в 1% агарозном геле. Агарозный гель-электрофорез проводили в приборах модели Sub-Cell GT WIDE MINI ("Bio-Rad", США). Фрагменты ДНК элюировали из легкоплавкой агарозы или при помощи набора для очистки ДНК ("Цитокин"). ПЦР проводили в амплификаторе производства компании "ДНК-технология" (Россия) с использованием ДНК-полимеразы Thermus aquaticus ("Хеликон", Россия). Для получения амплификатов промоторов с "тупыми" концами использовали Pfu ДНК-полимеразу ("Сибэнзим"). Для амплификации 35S промотора размером 510 п.н. (6930(7439 в координатах генома ВМЦК, номер доступа V00141.1) использовали праймеры: 35SF AGAGGACCTAACAGAACTCG и 35SR CGTGTTCTCTCCAAATGAAA, для амплификации промотора ВМГ: DMVF ATCAACGGAGAAACAAAGAT и DMVR ATGGGTTACTACTCACACAT, для амплификации промотора ВКГГ размером 501 п.н.: CERVF AGAAGATTTAATGGCAATCC и CERVR AGGACTTAGGCTCAACACAT. Для выделения промотора ВКГГ размером 371 п.н. были использованы праймеры CERVF и CERVR2: TTTTCGATGCCTTAACAATG. Подготовку и трансформацию компетентных клеток Escherichia coli осуществляли по методу Coen с соавт. [14]. Секвенирование проводили на автоматическом секвенаторе "ABI PRISM 310 Genetic Analyzer" ("Applied Biosystems", США). Электропорацию компетентных клеток Agrobacterium tumefaciens проводили при помощи электропоратора фирмы "Bio-Rad" модели Micropulser. Трансгенные формы табака получали методом агробактериальной трансформации листовых дисков [15].
Определение активности промотора. Активность промотора определяли путем количественного анализа экспрессии репортерного гена β-глюкуронидазы (GUS) флюориметрическим методом [16]. Для анализа брали замороженные и хранящиеся в течение 1(2 мес. при (70(С листья и стебли трансгенного табака (Nicotiana tabacum) поколения T0, а в некоторых случаях F1. Были использованы лишь растения с устойчивым и высоким уровнем экспрессии репортерного гена GUS во всех тканях, выявленного в ходе гистохимического анализа при помощи хромогенного субстрата 5-бром-4-хлор-3-индолил-β-D-глюкуронида (X-Gluc).
Растительную ткань растирали в ступке с жидким азотом, помещали в пробирку и добавляли экстрагирующий буфер следующего состава: 50 мМ Na-фосфатный буфер, рН 7(8, 10 мМ ЭДТА, 10 мМ β-меркаптоэтанол, 0.1% SDS, 0.1% Тритон Х-100. Перемешивали и центрифугировали на микроцентрифуге MiniSpin Plus фирмы "Eppendorf" при 14.5 об./мин, 5 мин. Определяли концентрацию белка в приготовленном клеточном экстракте по методу Брэдфорда. В заранее приготовленные микропробирки, содержащие по 200 мкл раствора субстрата (1 мМ 4-метилумбеллиферил-β-глюкуронид (4-MU)) в GUS-экстракционном буфере и прогретые до 37(С, добавляли по 20 мкл белкового экстракта (в двухкратной повторности) и быстро перемешивали с помощью встряхивателя для пробирок. Сразу после смешивания к одной из проб добавляли 0.8 мл стоп-раствора (0.2 М Na2CO3), которая служила нулевой точкой для определения собственной флюоресценции экстракта. Остальные пробирки инкубировали в течение 20 мин, после чего останавливали реакцию добавлением 0.8 мл стоп-раствора. Содержание 4-MU в полученных растворах определяли с помощью спектрофлюориметра LS55 фирмы "Perkin Elmer" (США). Заранее строили калибровочную кривую, пользуясь растворами 4-MU различной концентрации. Полученные результаты пересчитывали на мг белка.
Получение одноцепочечной ДНК. Одноцепочечную ДНК получали с помощью ДНК-полимеразы фага рhi29, характеризующейся высокой процессивностью и обладающей свойством смещать цепь ДНК, приводя к наработке длинного одноцепочечного продукта при использовании в качестве матрицы кольцевой молекулы ДНК [17]. Промоторы каулимовирусов, клонированные в фагмидном векторе pKRX были выщеплены с помощью эндонуклеазы рестрикции BsePI (изошизомер BssHI) и элюированы из легкоплавкой агарозы. При этом образовывалась цепь ДНК, состоящая из промоторной последовательности и небольшого участка полилинкера с "липкими" концами. Далее было проведено лигирование в 15 мкл реакционной смеси: 1.5 мкл буферf Т4 ДНК-лигазы (10(, "Fermentas"), 1.5 мкл ПЭГ 4000 ("Fermentas"), 0.3 мкл BSA (10 мг/мл, "Сибэнзим"), 1 мкл Т4 ДНК-лигазы (30 ед./мкл, "Fermentas"), 10 мкл раствора элюата промотора с "липкими" концами BsePI (1.5(2.0 мкг), 0.7 мкл дистиллированной воды MilliQ. Эту смесь держали при комнатной температуре в течение 1 ч, затем в холодильнике на 4(С в течение 16 ч. После инактивации лигазы (65(С, 10 мин) проводили депротеинизацию фенольно(хлороформной смесью. Полученную ДНК промывали 70% спиртом, подсушивали и растворяли в 10 мкл дистиллированной воды. Таким образом были получены кольцевые молекулы ДНК, содержащие преимущественно промоторные последовательности каулимовирусов, которые были использованы в качестве матрицы для амплификации по типу катящегося кольца. При этом могли быть получены кольцевые молекулы ДНК, содержащие как одну копию промотора, так и множество его копий. Амплификацию с ДНК-полимеразой фага phi29 проводили в 30 мкл: 3 мкл буфера ДНК-полимеразы фага phi29 (10(, "Fermentas"), 6 мкл dNTP (2.5 мМ, "Promega"), 10 мкл раствора, содержащего кольцевые молекулы ДНК, 2 мкл олигонуклеотидного праймера (2 опт.ед./мл), 8 мкл дистиллированной воды MilliQ, 0.5 мкл ДНК полимеразы фага phi29 (10 000 ед./мл, "New England Biolabs") 0.5 мкл пирофосфатазы (1000 ед./мл, "Сибэнзим"). Вначале смешивали буфер, dNTP, праймер, воду и проводили денатурацию при 96(С в течение 6(10 мин, затем помещали пробирки в холод (0(С) и сразу добавляли необходимые ферменты: полимеразу и пирофосфатазу. Реакцию полимеризации проводили в течение 1 суток при температуре 30(С. Инактивацию полимеразы осуществляли при температуре 65(С в течение 10 мин. После фенольно(хлороформной депротеинизации проверяли наличие наработанной ДНК при помощи агарозного гель-электрофореза. Полученные одноцепочечные ДНК использовали в качестве матрицы при ДНК-шаффлинге.
ДНК-шаффлинг. ДНК-шаффлинг проводили по Stemmer [9] с модификациями [11]. Вначале смешивали полученные одноцепочечные ДНК различных промоторов каулимовирусов. Образцы ДНК обрабатывали ДНКазой I (1 ед. акт.) в буфере (0.5 М Трис(НСl, рН 7.4, 0.1 М MgCl2) в течение 2 мин при 15(С. Реакцию останавливали добавлением ЭДТА до 25 мM и инкубацией смеси при 65(С в течение 20 мин. Затем осуществляли ПЦР без добавления праймеров в 30 мкл реакционной смеси: матричная ДНК, обработанная ДНКазой I (10 мкл), смесь всех четырех дезоксирибонуклеотидтрифосфатов (по 0.2 мМ каждый), буфер для Taq ДНК-полимеразы (60 мМ Трис(HCl, рН 8.5, 1.5 мМ MgCl2, 25 мМ KCl, 10 мМ меркаптоэтанол, 0.1% Тритон Х-100), Taq ДНК-полимераза (0.5(1.0 ед. акт.). 1 мкл из полученной реакционной смеси использовали для дальнейшего проведения ПЦР с добавлением специфических праймеров (прямой праймер одного промотора и обратный праймер другого промотора). Полученные амплификаты клонировали в Т-векторе pKRX. Затем осуществляли анализ плазмидного профиля при помощи агарозного гель-электрофореза, проводили амплификацию и секвенирование вставки, и по полученным данным осуществляли отбор гибридных форм промоторов.

РЕЗУЛЬТАТЫ

Получение гибридных форм промоторов каулимовирусов методом ДНК-шаффлинга

С помощью метода амплификации по типу катящегося кольца были наработаны в одноцепочечной форме промоторы ВМЦК (35S промотор), ВКГГ и ВМГ (рис. 1а). В качестве матрицы для этого были использованы промоторы каулимовирусов в кольцевой форме. Для удобства полученные промоторы каулимовирусов в одноцепочечной форме были обозначены нами согласно названию вируса и праймера, с которого данную цепь ДНК нарабатывали (прямой - F, обратный - R): 35S-F, 35S-R, CERV-F, CERV-R, DMV-F, DMV-R. Для проведения ДНК-шаффлинга были использованы все 6 комбинаций разных цепей ДНК этих промоторов: 35S-F + CERV-R (смесь 1); CERV-F + 35S-R (смесь 2); 35S-F + DMV-R (смесь 3); DMV-F + 35S-R (смесь 4); CERV-F + DMV-R (смесь 5); DMV-F + CERV-R (смесь 6). После проведения первого раунда ПЦР без добавления праймеров и второго раунда ПЦР с добавлением специфических праймеров весь пул полученных амплификатов (рис. 1б) был клонирован в векторе pKRX. ПЦР и электрофоретический анализ полученных клонов показали большое разнообразие амплификатов по размеру (рис. 1в, 1г). Наибольшее количество ПЦР продуктов было клонировано из смесей 1, 4 и 6 (рис. 1в, 1г). Из смесей 2, 3 и 5 удалось клонировать лишь небольшое количество ПЦР продуктов, которые, как стало известно после секвенирования, почти полностью представляли собой полноразмерные промоторы того или иного каулимовируса с небольшой вставкой участка промотора другого каулимовируса. По 2 клона из смесей 1, 4 и 6 были секвенированы, и анализ последовательностей показал получение разнообразных гибридных промоторов. Например, вариант 71 (7-й клон, смесь 1), оказался по размеру равным 715 п.н., в начале которого расположились 214 п.н. 35S промотора, а в конце 501 п.н. из промотора ВКГГ (рис. 2). Размер варианта 41 составил 905 п.н., который также состоял из смеси нуклеотидных последовательностей 35S промотора и промотора ВКГГ, а также участка полилинкера вектора pKRX (рис. 2). В целом надо отметить, что, видимо, из-за очень низкого уровня гомологии между исследуемыми промоторами каулимовирусов и очень короткого периода обработки ДНКазой I (2 мин при 15(С) полученные промоторы были гибридны по довольно крупным блокам, размером 200(500 п.н. Однако, согласно литературным данным и нашим предположениям, для более успешного ДНК-шаффлинга и осуществления молекулярной эволюции необходимым условием является химеризация по блокам меньшего размера, а именно 20(80 п.н. и одновременный анализ активности и отбор наиболее интересных форм из множества вариантов. Таким образом, эффективную молекулярную эволюцию можно осуществить только путем электропорации протопластов лигазной смесью, поэтому из-за многочисленных технических сложностей и все того же низкого уровня гомологии промоторов каулимовирусов такие эксперименты нами не проводились. 6 отобранных гибридных форм промоторов каулимовирусов, отличающиеся к тому же по размеру от природных форм, были выщеплены из вектора pKRX по сайтам EcoRI и SalI и направленно клонированы в бинарные векторы pCambia 1281Z/1291Z с репортерным геном GUS, сконструированные специально для анализа активности промоторов в трансгенных растениях [18]. Эти генно-инженерные конструкции были использованы для агробактериальной трансформации листовых дисков табака.

Получение гибридных форм промоторов каулимовирусов методами ПЦР, рестрикции-лигирования, клонирования и субклонирования
Для получения гибридных форм промоторов каулимовирусов методами ПЦР и рестрикции-лигирования были использованы промотор ВМГ размером 442 п.н. и промотор ВКГГ размером 501 п.н. Промотор ВМГ был расщеплен рестриктазой HindIII, при этом образовались два фрагмента размерами 249 и 193 п.н. При расщеплении той же рестриктазой промотора ВКГГ были получены также два фрагмента ( размерами 50 и 451 п.н. Фрагменты данных промоторов размерами 249 и 451 п.н. были лигированы Т4 ДНК-лигазой, лигазная смесь амплифицирована, а полученный амплификат клонирован в T-векторе pKRX. В итоге был получен гибридный промотор размером 700 п.н. (рис. 2), в начале которого расположились последовательности промотора ВМГ, а в конце последовательности промотора ВКГГ. Исследуемые промоторы также содержат по одному сайту узнавания эндонуклеазы рестрикции AatII. При расщеплении промотора ВМГ этой рестриктазой были получены фрагменты размерами 299 и 143 п.н., а промотор ВКГГ дал фрагменты размерами 286 и 215 п.н. После проведения перекрестных лигирований, амплификации методом ПЦР и клонирования в векторе pKRX были получены гибридные промоторы размерами 514 и 429 п.н. (рис. 2). Далее промоторы ВМГ и ВКГГ были амплифицированы при помощи Pfu ДНК-полимеразы, при этом были получены амплификаты с "тупыми" концами. Исследуемые промоторы расщеплялись рестриктазой ZraI, которая также расщепляет ДНК по "тупым" концам, при этом из промотора ВМГ образовались фрагменты размерами 297 и 145 п.н., а из промотора ВКГГ - 284 и 217 п.н. Фрагмент промотора ВКГГ размером 284 п.н. был лигирован с полноразмерным промотором ВМГ, в результате чего получили гибридный промотор размером 726 п.н. (рис. 2). Далее фрагмент промотора ВМГ размером 297 п.н. был лигирован с полноразмерным промотором ВМГ, при этом был получен модифицированный промотор ВМГ размером 739 п.н. (рис. 2). Все полученные в ходе работы гибридные промоторы были клонированы в бинарных векторах pCambia 1281Z/1291Z, и на основе этих генно-инженерных конструкций были получены трансгенные растения табака.

Определение активности природных и гибридных форм промоторов каулимовирусов флюориметрическим методом

Методом ДНК-шаффлинга нами были получены гибридные формы промоторов каулимовирусов гвоздики и георгина как друг с другом, так и с 35S промотором в различных комбинациях, 6 из которых были отобраны для проведения дальнейших анализов. Из гибридных между промоторами каулимовирусов цветной капусты и гвоздики было отобрано три варианта: 41, 71 и 141; между промоторами каулимовирусов цветной капусты и георгина отобрали 2 варианта: 94 и 114; между промоторами каулимовирусов гвоздики и георгина отобрали 1 вариант: 196 (во всех вариантах цифра означает номер клона, полученного при генно-инженерных манипуляциях, а надстрочный индекс означает номер смеси промоторов, см. выше). После проведения агробактериальной трансформации листовых дисков табака (рис. 3а) хорошо укоренившиеся на селективной среде с гигромицином трансгенные растения отбирали для проведения качественного гистохимического анализа активности репортерного гена GUS. По результатам проведенных анализов стало ясно, что для полученных нами гибридных и модифицированных форм промоторов каулимовирусов, как и для 35S промотора, характерна конститутивность и отсутствие тканеспецифичности (рис. 3). 6(9 растений с устойчивой активностью β-глюкуронидазы в листьях, стеблях и корнях (рис. 3б(3г) использовали для выяснения и сравнения силы промоторов флюориметрическим методом. Для анализа активности 35S промотора, например, было отобрано 19 хорошо укоренившихся растений, из которых 15 оказались GUS-положительными; количественный GUS-анализ 6 отобранных растений показал активность в среднем 26.2 ± 2.8 нмоль 4-MU/(мин мг белка). Для анализа промотора ВМГ использовали 6 GUS-положительных растений, количественный анализ которых показал активность в среднем 45.1 ± 10.2 нмоль 4-MU/(мин мг белка). Основные данные по проведенным экспериментам приведены в таблице. Из таблицы видно, что наиболее "сильным" из полученных нами гибридных и модифицированных форм промоторов каулимовирусов является промотор размером 739 п.н., а наиболее слабыми оказались гибридные промоторы размером 429 и 726 п.н. Объединив данные для всех полученных и исследованных нами гибридных и диких форм промоторов каулимовирусов можно привести следующий ряд, в котором все они представлены по убыванию активности в трансгенных растениях табака:
промотор ВМГ (442) > 739 > 144 > 700 > 514 > 196 > 94 > 35S промотор > 114 > промотор ВКГГ (371) >71 > 41 > 429 и 726 > промотор ВКГГ (501).

ОБСУЖДЕНИЕ

В результате проведенных экспериментов получен ряд сильных конститутивных растительных промоторов, различающихся по экспрессионной активности и нуклеотидной последовательности, при этом семь из них показали бóльшую, а семь меньшую, чем 35S промотор силу. Самым сильным из исследованных промоторов оказался промотор ВМГ дикого типа, который в наших экспериментах был активнее 35S промотора в 1.7 раза. Наименьшая активность была показана для промотора ВКГГ дикого типа размером 501 п.н., который оказался слабее 35S промотора в 2.7 раза. Промотор ВКГГ дикого типа размером 371 п.н. показал примерно равную с 35S промотором силу. Из этих данных можно делать выводы, что для проявления полной экспрессионной активности промотору ВКГГ достаточно 371 п.н. Наиболее слабые варианты промоторов, а именно варианты 501, 429 и 726 объединяет наличие на 5'-конце блока размером 280 п.н., часть которого, вероятнее всего, не входит в состав промотора, а относится к гену 6 каулимовирусов. Промотор ВКГГ размером 371 п.н. содержит на 130 п.н. меньше промотора 501 с 5'-конца, и это заметно способствует увеличению его экспрессионной активности. Судя по всему, именно этот участок размером 130 п.н. способствует уменьшению активности экспрессии, так как не содержит энхансерных доменов и, вероятнее всего, не относится к промоторной последовательности. Напротив, для амплификации промотора ВМГ, нами был изначально выбран оптимальный участок, так как все гибридные промоторы, содержащие его 5'-конец, отличаются высокой активностью. Как известно, около 300 первых нуклеотидов, промоторов каулимовирусов соответствуют так называемой энхансерной области [5]. Видимо, в этом случае был выделен полноразмерный промотор ВМГ с полной энхансерной областью, без значительной примеси открытой рамки считывания гена 6 каулимовирусов. Поэтому не удивительно, что из гибридных промоторов наибольшую активность показал модифицированный промотор ВМГ размером 739 п.н., так как он теоретически должен содержать две энхансерные области. При проведении экспериментов предполагалось, что данный модифицированный промотор покажет бóльшую силу, чем природный промотор ВМГ, однако этого не удалось подтвердить. Таким образом, наши данные не совпали с литературными, где имеются сообщения о большей активности промоторов каулимовирусов с двумя энхансерными областями, по сравнению с природными промоторами каулимовирусов с одной энхансерной областью [19].
Такие результаты могут быть связаны как с возможными мутациями промотора при генно-инженерных манипуляциях, так и с низким уровнем активности промотора в отобранных по варианту 739 трансгенных растениях табака. Эти предположения подтверждаются также нашими экспериментальными данными, показывающими, что активность одного и того же промотора в разных растениях табака варьирует в достаточно широком диапазоне. Выявленные различия между активностями исследованных промоторов не очень большие, поэтому эти данные не противоречат, а лишь дополняют данные наших предыдущих исследований, когда был сделан вывод, что 35S промотор и промоторы каулимовирусов гвоздики и георгина примерно одинаковы по активности в трансгенных растениях табака [13].
C момента начала наших исследований в 2007 г. и до настоящего времени не появилась ссылка ни на одну работу, где бы упоминался промотор вируса мозаики георгина. Упоминание о промоторе вируса кольцевой гравировки гвоздики имеется в работах английских исследователей из Бедфорда [20]. Этими исследователями был клонирован промоторный участок ВКГГ размером 380 п.н. (6737(7118), который практически совпадает с исследуемым нами промоторным участком ВКГГ размером 371 п.н. (6721(7091). Этот промотор был использован для различных целей, например, для проверки экспрессии гена стерол типа С-24 метилтрансферазы, что позволило добиться увеличения количества стеролов на 44% [20]. Однако эти исследователи не изучали силу промотора, а использовали его как инструмент для достижения сверхэкспрессии определенных целевых белков. Из группы каулимовирусов, кроме 35S промотора, были исследованы промоторы вируса мозаики норичника [21], вируса мозаики ночной красавицы [22], вируса, окаймляющего жилки земляники [23], и некоторые другие. Необходимо отметить, что все они, как и промотор ВМГ, показали немного большую, чем 35S промотор, активность в трансгенных растениях.
Кроме поиска новых сильных природных промоторов, активно ведутся исследования по созданию модифицированных промоторов каулимовирусов. Например, 35S промотор с двумя энхансерными областями оказался почти в два раза сильнее того же промотора с одной энхансерной областью [19]. Сконструированы гибриды 35S промотора и промотора маннопинсинтазы, которые показали в 3(5 раз больший уровень экспрессии, чем 35S промотор с двумя энхансерными областями [19]. Химерный промотор, содержащий промоторный участок пшеничного гена (-амилазы и две энхансерные области 35S промотора, показал высокую активность в протопластах и трансгенных растениях риса [24]. Было сконструировано большое количество промоторных кассет при помощи различных комбинаций регуляторных доменов 35S промотора, интронов растительных генов, терминаторов 35S промотора и промотора нопалинсинтазы [7]. Некоторые из этих полученных промоторных кассет оказались заметно сильнее 35S промотора, что говорит о колоссальных возможностях генно-инженерных технологий в улучшении природных промоторов каулимовирусов.
Весьма интересна работа индийских авторов, создавших серию химерных промоторов на основе 35S, где они меняли местами домены [25]. Эти исследования были направлены не только на усиление транскрипционной активности трансгенов; главное ( это то, что были созданы равные по силе промоторы с отличающейся нуклеотидной последовательностью, что может иметь большое значение для преодоления такого явления как "молчание" трансгенов.
Наши эксперименты также были направлены не только на исследование промоторов каулимовирусов, но и преследовали цель получения растительных промоторов с различной активностью, а также преодоления проблем, связанных с "молчанием" трансгенов. В рамках проведенных исследований для получения промоторных последовательностей в одноцепочечной форме мы впервые применили ДНК-полимеразу фага рhi 29 и небольшие кольцевые молекулы ДНК, состоящие только из промотора. Впервые с использованием различных молекулярно-биологических методов были получены гибридные между различными каулимовирусами формы промоторов и определена их активность в трансгенных растениях. Из исследованных нами промоторов, для создания трансгенных растений-продуцентов физиологически активных веществ, когда одним из требований является повышенное содержание целевого белка в тканях, наиболее оптимальным будет применение промотора ВМГ размером 442 п.н. При проведении различных фундаментальных исследований, особенно в случае высокой вероятности летальности трансгенных растений из-за сверхэкспрессии целевого белка, более предпочтительным будет применение промотора ВКГГ размером 501 п.н., который примерно в 4 раза слабее промотора ВМГ размером 442 п.н. Однако необходимо отметить, что промотор ВКГГ размером 501 п.н. все же является более активным, чем промотор маннопинсинтазы из Т-ДНК агробактерий и может поддерживать уровень экспрессии целевого белка на достаточно высоком уровне. Мы планируем использовать полученные промоторы для создания генно-инженерных конструкций, пригодных для эктопической экспрессии различных генов в трансгенных растениях.
Работа выполнена при финансовой поддержке программы "Участник Молодежного научно-инновационного конкурса" ("УМНИК") (государственный контракт № 5490р/7971), Федеральной целевой программы "Научные и научно-педагогические кадры инновационной России" на 2009(2013 гг." НК-192П (государственный контракт П1368), НШ-649.2008.4 (государственный контракт № 02.740.11.0290) и Федеральной целевой программы "Исследования и разработки по приоритетным направлениям развития научно-технологического комплекса России на 2007(2012 гг." (государственный контракт № 02.518.11.7138).


СПИСОК ЛИТЕРАТУРЫ
1. Рукавцова Е.Б., Абрамихина Т.Б., Шульга Н.Я., Быков В.А., Бурьянов Я.И. Тканеспецифическая экспрессия поверхностного антигена вируса гепатита B в клетках трансгенных растений и культуры тканей // Физиология растений. 2007. Т. 54. С. 864-869.
2. Luo K., Sun M., Deng W., Xu S. Excision of Selectable Marker Gene from Transgenic Tobacco Using the GM-Gene-Deletor System Regulated by a Heat-Inducible Promoter // Biotechnol. Lett. 2008. V. 30. P. 1295-1302.
3. Парашина Е.В., Сердобинский Л.А., Калле Е.Г., Лаврова Н.В., Аветисов В.А., Лунин В.Г., Народицкий Б.С. Получение трансгенных растений рапса и томата, экспрессирующих ген дефензина редьки с применением новой векторной конструкции на базе плазмиды RSF1010 // Физиология растений. 2000. Т. 47. С. 471-478.
4. Hu Y., Poh H., Chua N. The Arabidopsis ARGOS-LIKE Gene Regulates Cell Expansion during Organ Growth // Plant J. 2006. V. 47. P. 1-9.
5. Lam E. Analysis of Tissue-Specific Elements in the CaMV 35S Promoter // Result. Probl. Cell Different. 1994. V. 20. P. 181-196.
6. De Mesa M.C., Santiago-Domenech N., Pliego-Alfago F., Quesada M.A., Mercado J.A. The CaMV 35S Promoter Is Highly Active on Floral Organs and Pollen of Transgenic Strawberry Plants // Plant Cell Rep. 2004. V. 23. P. 32.
7. Mitsuhara I., Ugaki M., Hirochika H. Efficient Promoter Cassettes for Enhancer Expression of Foreign Genes in Dicotyledonous and Monocotyledonous Plants // Plant Cell Physiol. 1996. V. 37. P. 49-59.
8. Mizukami Y., Fisher R. L. Plant Organ Size Control: AINTEGUMENTA Regulates Growth and Cell Numbers during Organogenesis // Proc. Natl. Acad. Sci. USA. 2000. V. 97. P. 942-947.
9. Stemmer W.P.C. Rapid Evolution of a Protein In Vitro by DNA Shuffling // Nature. 1994. V. 8. Р. 389-391.
10. Remans T., Grof C.P.L., Ebert P.R. Functional Promoter Analysis Using an Approach Based on an In Vitro Evolution Strategy // Bioteсniques. 2005. V. 38. P. 209-216.
11. Kikuchi M., Ohnini K., Harayama S. An Effective Shuffling Method Using Single-Stranded DNA // Gene. 2000. V. 243. P. 133-137.
12. Кулуев Б.Р., Чемерис А.В. Амплификация и клонирование промоторов вируса мозаики георгина и вируса кольцевой гравировки гвоздики // Генетика. 2007. Т. 43. С. 1682-1684.
13. Кулуев Б.Р., Чемерис А.В., Князев А.В. Активность промоторов вируса мозаики георгина и вируса кольцевой гравировки гвоздики в протопластах и трансгенных растениях табака // Физиология растений. 2008. Т. 55. С. 763-770.
14. Cohen S.N., Chang A.C.Y., Hsu L. Nonchromosomal Antibiotic Resistance in Bacteria - Genetic Transformation of E. coli by R-Factor DNA // Proc. Natl. Acad. Sci. USA. 1972. V. 69. P. 2110-2114.
15. Horsch R., Fry J., Hoffmann N., Eichholtz D., Rogers S., Fraley R. A Simple and General Method for Transferring Genes into Plants // Science. 1985. V. 227. P. 1229-1231.
16. Jefferson R. Assaying Chimeric Genes in Plants: The GUS Gene Fusion System // Plant Mol. Biol. Rep. 1987. V. 5. P. 387-405.
17. Esteban J.A., Salas M., Blanco L. Fidelity of phi 29 Polymerase // J. Biol. Chem. 1993. V. 268. P. 2719-2726.
18. Hajdukiewicz P., Svab Z., Maliga P. The Small, Versatile pPZP Family of Agrobacterium Binary Vectors for Plant Transformation // Plant Mol. Biol. 1994. V. 25. P. 989-994.
19. Comai L., Moran P., Maslyar D. Novel and Useful Properties of Chimeric Plant Promoter Combining CaMV 35S and MAS Elements // Plant Mol. Biol. 1990. V. 15. P. 373-381.
20. Holmberg N., Harker M., Gibbard C.L., Wallace A.D., Clayton J.C., Rawlins S., Hellyer A., Safford R. Sterol C-24 Methyltransferase Type 1 Controls the Flux of Carbon into Sterol Biosynthesis in Tobacco Seed // Plant Physiol. 2002. V. 130. P. 303-311.
21. Sanger M., Daubert S., Goodman R.M. Characteristics of a Strong Promoter from Figwort Mosaic Virus: Comparison with the Analogous 35S Promoter from Cauliflower Mosaic Virus and Regulated Mannopine Synthase Promoter // Plant Mol. Biol. 1990. V. 14. P. 433-443.
22. Dey N., Maiti I.B. Structure and Promoter/Leader Deletion Analysis of Mirabilis Mosaic Virus (MMV) Full-Length Transcript Promoter in Transgenic Plants // Plant Mol. Biol. 1999. V. 40. P. 771-782.
23. Pattanaik S., Dey N., Bhattacharyya S., Maiti I. Isolation of Full-Length Transcript Promoter from the Strawberry Vein Banding Virus (SVBV) and Expression Analysis by Protoplasts Transient Assays and in Transgenic Plants // Plant Sci. 2004. V. 167. P. 427-438.
24. Omirulleh S., Abraham M., Golovkin M., Stefanov I., Karabaev M.K., Mustardy L., Morocz S., Dubits D. Activity of a Chimeric Promoter with the Doubled CaMV 35S Enhancer Element in Protoplast-Derived Cells and Transgenic Plants in Maize // Plant Mol. Biol. 1993. V. 21. P. 415-428.
25. Bhullar S., Chakravarthy S., Advani S., Datta S., Pental D., Burma P.K. Strategies for Development of Functionally Equivalent Promoters with Minimum Sequence Homology for Transgene in Plants: cis-Elements in a Novel DNA Context versus Domain Swapping // Plant Physiol. 2003. V. 132. P. 988-998.

 ПОДПИСИ К РИСУНКАМ

Рис. 1. Электрофореграммы результатов амплификации по типу катящегося кольца и ДНК-шаффлинга.
а - результаты амплификации по типу катящегося кольца, где 1, 2, 5 и 6 - одноцепочечная ДНК промоторов ВМЦК и ВКГГ; 3, 4, 7 и 8 - результаты полимеразной реакции с тех же матриц, но в которой не проводили лигирование и закольцовывание; б - результаты ДНК-шаффлинга промоторов ВМЦК и ВКГГ после двух раундов ПЦР, где в качестве маркера использовали ДНК фага λ, расщепленная BstEII; в - ПЦР-анализ клонов, полученных при клонировании амплификата из смеси 1 после ДНК-шаффлинга в Т-векторе pKRX, где 1(7 - номера анализируемых клонов, 8 - амплификат промотора ВКГГ размером 501 п.н.; г - ПЦР-анализ клонов, полученных при клонировании амплификата из смеси 4 после ДНК-шаффлинга в Т-векторе pKRX, где 1 - амплификат промотора ВМЦК размером 510 п.н., 2 - промотор ВМГ размером 442 п.н., 3-25 - номера анализированных форм.

Рис. 2. Схемы некоторых полученных в ходе экспериментальной работы гибридных промоторов каулимовирусов.

Рис. 3. Гистохимический анализ трансгенных по различным промоторам растений при помощи хромогенного субстрата x-gluc.
а - экспрессия репортерного гена GUS в трансгенном каллусе; б - экспрессия репортерного гена GUS в листьях; в - экспрессия репортерного гена GUS в стеблях; г - экспрессия репортерного гена GUS в корнях.