УДК 581.1

 

СУБСТРАТНАЯ СПЕЦИФИЧНОСТЬ АЦИЛ-ЛИПИДНОЙ ∆9-ДЕСАТУРАЗЫ ЖИРНЫХ КИСЛОТ ИЗ ЦИАНОБАКТЕРИИ CYANOBACTERIUM SP. IPPAS B-1200 С НЕОБЫЧНЫМ ЖИРНОКИСЛОТНЫМ СОСТАВОМ

© 2018 г. А. Ю. Стариков1, А. А. Усербаева2, К. С. Миронов1, Р. А. Сидоров1, Б. К. Заядан2, В. С. Бедбенов1, М. А. Синетова1, Д. А. Лось1, *

1Федеральное государственное бюджетное учреждение науки Институт физиологии растений им. К.А. Тимирязева Российской академии наук, Москва

2Факультет биологии и биотехнологии Казахского национального Университета им. Аль-Фараби, Алматы, Республика Казахстан

Поступила в редакцию 14.07.2017 г.

Cyanobacterium sp. IPPAS B-1200 характеризуется высоким содержанием в мембранных липидах таких жирных кислот (ЖК) как миристиновая (14:0 – 30%) и миристоолеиновая (14:1Δ9 – 10%). Таким образом, “короткие” ЖК составляют 40% от общей массы ЖК, что крайне необычно для цианобактерий. Мононенасыщенная пальмитолеиновая кислота (16:1Δ9) также достигает 40% от суммы ЖК. Мы определили нуклеотидную последовательность генома этой цианобактерии и обнаружили в нем лишь один ген десатуразы ЖК, кодирующий ацил-липидную Δ9-десатуразу DesC1. Для определения специфичности DesC1 к длине ЖК этот ген клонировали и экспрессировали в клетках Escherichia coli. Результаты показывают, что десатураза DesC1 проявляет активность в положении Δ9 неспецифично по отношению к длине цепи ЖК и способна образовывать двойные связи в С14, С16 и С18 ЖК. Это свидетельствует о том, что наличие всех мононесащенных кислот в клетках Cyanobacterium определяется активностью одной единственной Δ9-десатуразы.

 

Ключевые слова: Cyanobacterium геном – десатуразы – жирные кислоты – цианобактерии – экспрессия генов

 

_____________________

*Адрес для корреспонденции: Лось Дмитрий Анатольевич. 127276 Москва, Ботаническая ул., 35. Институт физиологии растений им. К.А. Тимирязева РАН. Электронная почта: losda@ippras.ru

ВВЕДЕНИЕ

Цианобактерии являются одними из самых древних организмов на Земле. Они широко распространены в различных средах обитания, составляют значительную часть океанического и пресноводного фитопланктона и привлекают внимание исследователей разнообразием метаболитов, некоторые из которых могут быть использованы в качестве пищевых добавок и лекарственных препаратов, или как источники альтернативного топлива. Одним из видов альтернативного топлива является биотопливо, представленное различными органическими соединениями – биогаз, спирты, метиловые эфиры жирных кислот (ЖК), которые получают не химическим синтезом или добычей из недр земли, а путем переработки растительного сырья [1]. Помимо привычных масличных культур, перспективным представляется получение этих органических соединений из биомассы фотоавтотрофных организмов, например, микроводорослей и цианобактерий, которые имеют ряд характеристик, представляющих как научный, так и практический интерес [1, 2].

Способность цианобактерий к фотосинтезу, а также принадлежность к прокариотам, возможность культивирования на средах, содержащих только минеральные элементы, – все эти особенности позволяют получать большее количество биомассы, чем при использовании гетеротрофных клеток при сравнимых расходах [1]. Продуктивность того или иного штамма цианобактерий можно повысить стандартными микробиологическими методами (выделение чистых культур, их характеристика, подбор условий культивирования), а также применяя методы молекулярной биологии и генной инженерии [2–4]. Изменяя метаболические пути в нужном направлении, можно увеличить выход целевого продукта [5, 6], или получить нехарактерные для организма продукты [7, 8].

ЖК входят в состав липидов клеточных мембран, являются основными компонентами растительного масла и животных жиров, выполняя структурные, запасающие и регуляторные функции [9]. Разнообразие ЖК формируется за счет работы множества ферментов, обеспечивающих их синтез и модификацию. Так, десатуразы ЖК у цианобактерий образуют двойные углеродные связи ЖК мембранных липидов. Это приводит к изменению “геометрии” ЖК и, следовательно, к изменению их физических свойств (вязкости, температуры плавления липидов). Десатуразы меняют качественный состав ЖК в сторону их ненасыщенности и тем самым участвуют в регуляции устойчивости клеток к низкотемпературному стрессу (за счет снижения вязкости клеточных мембран). Принципы регуляции вязкости биологических мембран, открытые и исследованные с использованием цианобактерий, с успехом применяются и на высших растениях. Например, табак или картофель, трансформированные генами ацил-липидных десатураз цианобактерий, обнаруживали повышенную устойчивость к низкотемпературному стрессу [6, 10].

Таким образом, изучение десатураз цианобактерий актуально не только для фундаментальной науки, но также востребовано в биотехнологическом и аграрном производстве. Применение современных научных знаний и методов дает возможность управлять продуктивностью культур цианобактерий, а также расширять спектр веществ, которые они способны производить. Поэтому исследование организмов с необычным ЖК-составом и изучение десатураз ЖК представляется актуальным.

Cyanobacterium sp. IPPAS B-1200 – штамм цианобактерии, изолированный из образцов, полученных из соленого бессточного озера Балхаш, располагающегося на юго-востоке Казахстана (46°32′27″ с.ш. 74°52′44″ в.д.) [3]. У Cyanobacterium были обнаружены только мононенасыщенные ЖК, поэтому этот штамм можно отнести к группе 1 по ЖК-классификации [11]. Наличие мононенасыщенных ЖК с двойными связями в положении Δ9 означает, что в этих клетках функционирует одна или несколько Δ9-десатураз. Важно отметить, что для подавляющего большинства цианобактерий типичными являются С16 и С18 ЖК. У Cyanobacterium, наряду с С16 ЖК, в большом количестве обнаруживались С14 ЖК – насыщенная миристиновая и мононенасыщенная миристолеиновая кислоты [3]. Необычный состав ЖК делает эту цианобактерию интересным объектом не только для фундаментальных исследований, но и для биотехнологической промышленности. Детальный анализ ЖК-профилей клеток цианобактерий, выращенных при различных температурах, позволил сделать вывод, что для данной цианобактерии не характерно изменение в качественном и количественном составе ЖК при снижении температур. Данный факт необычен, так как индукция десатураз является характерным ответом на холодовой стресс.

Ранее мы определили нуклеотидную последовательность генома Cyanobacterium и осуществили его черновую сборку [12] с использованием платформы Ion Torrent PGM™ [13]. Цель данной работы – поиск ген(а)ов десатураз(ы) ЖК и характеристика ее/их энзиматической активности при помощи гетерологичной экспрессии в клетках Escherichia coli.

 

МАТЕРИАЛЫ И МЕТОДЫ

Штамм Cyanobacterium sp. IPPAS B-1200 был изолирован из образцов воды озера Балхах (Республика Казахстан) [3]. Штамм выращивали на среде Заррука [2].

Секвенирование генома. Геномную ДНК выделяли по методу Вильямса [14] с дополнительной очисткой [15]. Оценку количества ДНК в полученных образцах проводили при помощи спектрофотометра NanoDrop 1000 (“NanoDrop Technologies Inc.”, США). Для оценки качества проводили электрофоретическое разделение фрагментов в 1% агарозном геле на основе трис-ацетатного буфера, содержавшего бромистый этидий. Библиотеку фрагментов геномной ДНК для секвенирования получали при помощи Ion Xpress™ Plus Fragment Library Kit (“Thermo Fisher Scientific”, США). Для точной оценки количества двухцепочечной ДНК использовали флуориметр Qubit® 3.0 (“Thermo Fisher Scientific”, США). 1 мкг геномной ДНК обрабатывали смесью нуклеаз для получения фрагментов длиной 150–250 п.н. После этого к фрагментированной ДНК лигировали адаптеры для секвенирования. Полученную библиотеку обрабатывали магнитными частицами Agencourt™ AMPure™ XP, согласно протоколу фирмы NEB (https://www.neb.com/protocols/1/01/01/size-selection-e6270). Очищенные и отобранные по размеру фрагменты библиотеки геномной ДНК элюировали в 25 мкл воды.

Оценку молекулярного веса отобранных фрагментов проводили при помощи электрофоретического разделения в агарозном геле (1%) на основе трис-ацетатного буфера при напряженности 8 В см-1. Оценку количества ДНК проводили, используя флуориметр Qubit® 3.0. Фактор разбавления библиотеки для последующей эмульсионной ПЦР рассчитывали по методикам производителя. После разбавления концентрация разбавленной библиотеки равнялась 100 пМ.

Эмульсионную ПЦР проводили на приборе Ion OneTouch™ 2 ("Thermo Fisher Scientific", США). Процедуру эмульсионной ПЦР и последующее обогащение пробы сферами, содержащими амплифицированные фрагменты, проводили, используя набор реактивов Ion PGM™ Hi-Q™ OT2 Kit (“Thermo Fisher Scientific”, США).

Для проведения секвенирования использовали Ion PGM Hi-Q Sequencing Kit и микрочип Ion 316™ Chip v2 BC. При проведении всех процедур строго соблюдались протоколы производителя реактивов (“Thermo Fisher Scientific”, США).

Сборка и аннотирование генома. Для сборки de novo генома Cyanobacterium был использован ассемблер SPAdes 3.1.0, входящий в пакет программного обеспечения Torrent Suite [16]. Полученный геном аннотировали с помощью программы NCBI - Prokaryotic Genome Annotation Pipeline (PGAP). Среди аннотированных генов искали десатуразы ЖК, после чего проводили выравнивание с известными генами десатураз цианобактерий с доказанными экспериментально (либо предсказанными in silico) функциями. Для выравнивания этих последовательностей и построения древа использовали алгоритм Muscle [17, 18] с предустановленными по умолчанию параметрами. Для визуализации результатов применяли программу CLC Sequence Viewer (“QIAGEN Bioinformatics”, США) CLC Sequence Viewer [19].

Клонирование гена Δ9-десатуразы из Cyanobacterium sp. IPPAS B-1200. Для проведения гетерологичной экспрессии нами была сконструирована плазмида, содержащая ген ацил-липидной Δ9-десатуразы desC, амплифицированный с помощью ПЦР. В качестве матрицы использовали геномную ДНК Cyanobacterium. Подбор праймеров для амплификации соответствующей кодирующей последовательности, фланкированной сайтами рестрикции Nco I (ATAACCATGGCAGTTTCAAC) и Hind III (TTTGAAGCTTTTATTATGCC) проводили с помощью программы Vector NTI. Помимо праймеров (0.1 мкМ) и ДНК, в реакционную смесь входили нуклеотиды (0.2 мM), хлорид магния (2 мM) и ДНК-полимераза Phusion® High-Fidelity DNA Polymerase (“New England Biolabs”, США). ПЦР включала в себя предварительную денатурацию ДНК (30 с, 98ºC), и 30 циклов, состоящих из последовательных стадий: денатурация ДНК (10 с, 98ºC), отжига праймеров (30 с, 57ºC) и синтеза цепи ДНК (2 мин, 72ºC), с последующим дополнительным синтезом цепи ДНК в течение 5 мин при 72ºC.

После завершения ПЦР концентрацию MgCl2 в ПЦР-смеси доводили до 10 мМ и вносили соответствующие рестриктазы в 5-кратном количестве. Смесь инкубировали при 37ºC 1 час. Полученные в результате подобной “ПЦР-рестрикции” фрагменты ДНК чистили с помощью электрофореза с последующим выделением фрагментов из геля с использованием GeneJet™Gel Extraction Kit (“Thermo Fisher Scientific”, США). Фрагменты ДНК элюировали в 25 мкл воды.

Обработку вектора pTrc99a и фрагментов ДНК проводили с помощью ферментов рестрикции Nco I и Hind III. Вектор дефосфорилировали с помощью щелочной фосфатазы FastAP (“Thermo Fisher Scientific”, США). Очистку подготовленного вектора проводили при помощи гель-электрофореза с последующим выделением ДНК из геля. Лигирование вектора и вставки проводили с использованием ДНК-лигазы фага T4, согласно протоколам фирмы-изготовителя (“Fermentas”, Литва). Полученная конструкция для экспрессии обозначена как pTrc99A-desC.

Гетерологичная экспрессия. Клетки E. сoli штамма Rosetta трансформировали плазмидой pTrc99A-desC. Проросшие колонии инокулировали в 100 мл свежей среды М9, с добавлением 1 мМ MgSO4, 0.5 мкг/мл витамина B1, 0.2% глюкозы, 0.1% казаминовых кислот, 100 мкг/мл ампициллина, 10 мкМ FeCl3 и растили при 37ºС до оптической плотности 0.5 (при длине волны 660 нм). Затем в культуру клеток добавляли индуктор изопропилтиогалактозид (ИПТГ) до конечной концентрации 100 мкМ и продолжали инкубацию в течение 4 часов [14], после чего пробы фиксировали.

Анализ экспрессии DesC в клетках E. сoli осуществлялся при помощи метода электрофореза в ПААГ в присутствии ДСН, согласно Лэммли с модификациями [20]. Для проведения электрофореза использовали камеру Mini-PROTEAN™ Tetra Cell (“Bio-Rad”, США). Толщина ПААГ, задаваемая спейсерами, составляла 0.75 мм. Разделяющий гель содержал 12.5%, концентрирующий гель – 5% акриламида.

Хроматографический анализ ЖК. Клетки отмывали фосфатным буфером (PBS) и фиксировали десятикратным объемом изопропанола, содержащего 20 мг/л ионола. Для анализа ЖК суммарных липидов пробы подвергали пере-этерификации. Для этого пробу смешивали со смесью метанол-ацетил хлорид (9:1) и нагревали при 70ºC 60 мин. Полученные метиловые эфиры ЖК анализировали при помощи газо-жидкостного хроматографа Agilent 7890A (“Agilent Technology Systems”, США) с масс-спектрометрическим детектором Agilent 5975С. Использовали капиллярную колонку DB-23 длиной 60 м и диаметром 0.25 мм (“Fisher Scientific”, Великобритания). Остальные условия проведения анализа: газ носитель – гелий, скорость потока 1 мл/мин, объем вводимого образца 1 мкл, делитель потока 1:5, температура испарения 260ºC. Программа для градиентного анализа: от 130º до 170ºC с шагом в 6.5ºC мин-1; от 170º до 215ºC с шагом в 2.5ºC мин-1, 215ºC в течение 25 мин, от 215º до 240ºC с шагом 40ºC мин-1; и окончательная стадия продолжительностью 50 мин при 240ºC. Рабочая температура масс-спектрометрического детектора была 240ºC, энергия ионизации 70 эВ.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Секвенирование и аннотирование генома Cyanobacterium sp. IPPAS B-1200

Несмотря на неполную загрузку чипа, распределение длины прочтений соответствует оптимальному и достаточному для сборки полного генома. Итоговый объем полученной информации – 444 миллиона п.н. При размере генома порядка 4 миллионов п.н. величина покрытия более чем 100-кратная. Подобное покрытие свидетельствует о достоверности результатов секвенирования.

Сборку генома производили с использованием ассемблера SPAdes версии 3.1.0. Параметры сборки: -k (21, 33, 55, 77, 99, 127), -s, -iontorrent. Число полученных контигов – 119. Качество сборки анализировали при помощи программы QUAST. Среднее покрытие составило 200×, величина N50 достигла 80222 п.н. Оценочный размер генома 3.4 миллиона п.н., содержание G+C 37.7% [12]. Таким образом, получена черновая сборка генома Cyanobacterium sp. IPPAS B-1200 (номер в базе данных GenBank NZ_LWHC00000000.1). Он представляет собой набор контигов (отдельных фрагментов) ДНК. Считается, что в первую очередь "собираются" именно уникальные последовательности ДНК, а не повторяющиеся участки [21], поэтому среди такого набора фрагментов с высокой вероятностью окажутся и гены, представляющие интерес для исследования.

При автоматическом аннотировании установлено, что геном содержит всего 3119 гена: 2934 гена, кодирующих белки, 137 псевдогена, 4 последовательности, кодирующие рРНК, 40 – тРНК, и 4 некодирующих РНК. Также в геноме обнаружено 2 CRISPR участка (clustered regularly interspaced short palindromic repeats – локусы, состоящие из прямых повторяющихся последовательностей, которые разделены уникальными последовательностями). При анализе результатов аннотирования был обнаружен единственный ген, кодирующий ацил-липидную десатуразу ЖК.

Выравнивание аминокислотной последовательности десатуразы ЖК Cyanobacterium (рис. 1) с последовательностями уже известных десатураз цианобактерий (например, Synechocystis sp. PCC 6803 – DesA, DesB, DesC и DesD) [22–24] показало, что десатураза Cyanobacterium относится к группе DesC1, включающей ферменты, катализирующие реакцию дегидрирования Δ9-связи ЖК мембранных липидов, находящихся в положении sn-1 глицерина [25].

Таким образом, данные биоинформатического анализа (рис. 1) говорят о том, что единственная десатураза ЖК Cyanobacterium sp. IPPAS B-1200 относится к группе DesC1 (ацил-липидные Δ9-десатуразы). Эти результаты согласуются с литературными данными, свидетельствующими о наличии в геноме лишь одного гена десатуразы ЖК у родственной цианобактерии, Cyanobacterium stanierii PCC 7202 [26]. Ранее полученные нами данные, описывающие ЖК состав липидов Cyanobacterium, свидетельствуют о наличии только насыщенных и мононенасыщенных ЖК с двойной связью в положении Δ9 [3].

Клонирование и экспрессия гена desC1 в клетках E. coli

В результате клонирования мы получили плазмиду pTrc99A::desC, которая экспрессирует DesC1 под контролем промотора Ptrc. Первичный отбор клонов проводили с помощью ПЦР-скрининга трансформантов. Проведено 16 независимых ПЦР (включая 2 негативных контроля и 1 положительный) в результате которых 14 из 16 реакций показали положительный результат на наличие вставки (рис. 2а). Размеры всех ПЦР-продуктов полностью соответствуют расчетным величинам (828 п.н.). Плазмидную ДНК из ПЦР-позитивных клонов проверяли с помощью рестрикционного анализа, обрабатывая смесью ферментов Nco I и Hind III. В качестве отрицательного контроля использовали целый pTrc99A вектор без вставки. На фото (рис. 2б) представлены данные типичного рестрикционного анализа, в котором тестировали сконструированную плазмиду на наличие вставки desC1. Наличие полосы размером около 800 п.н. является доказательством наличия вставки в проверяемом векторе. Теоретический расчет дает следующие размеры фрагментов: 828 и 4128 п.н., что в сумме дает теоретическую величину (4956 п.н.) целого вектора.

Наличие в пробах, трансформированных полученной конструкцией и подвергшихся индукции, белка размером около 30 кДа, что близко к теоретической величине (32.1 кДа), и отсутствие его в других образцах, говорит о том, что экспрессия гена desC в трансформантах состоялась (данные не приведены). Низкий уровень экспрессии и расхождение с теоретическим размером характерно для мембранных десатураз, экспрессированных в гетерологических системах [27].

Хроматографический и масс-спектрометрический анализ ЖК

Пробы, полученные в результате гетерологичной экспрессии, анализировали с помощью ГЖХ и масс-спектрометрии. Были получены хроматографические профили (рис. 3) и рассчитано содержание индивидуальных ЖК в каждом из образцов (таблица).

Данные анализа ЖК состава позволяют судить не только о специфичности десатуразы Cyanobacterium sp. IPPAS B-1200 к положению двойной связи в цепи ЖК (которая, без сомнений, образуется в положении Δ9), но и определить предпочтения фермента относительно длины углеродной цепи. Клетки E. coli содержат достаточные для анализа количества насыщенных С14 и С16 кислот, которые могут служить субстратами для Δ9-десатуразы. В то же время у E. coli очень мало стеариновой кислоты, в связи с чем доля олеиновой кислоты, синтезированной трансформантами, невелика.

Клетки E. coli совсем не содержат С18 мононенасыщенных ЖК с двойной связью в положении Δ9 [28]. У E. coli мононенасыщенная С18 ЖК представлена продуктом анаэробного пути синтеза ненасыщенных ЖК – цис-вакценовой кислотой (18:1Δ11), которая образуется при удлинении 16:1Δ9 синтазой ЖК в результате двух последовательных биохимических реакций. Двойная связь в пальмитолеиновой кислоте у E. coli также формируется при синтезе ЖК, а не в результате реакции О2-зависимой десатурации [29].

Мононенасыщенные 18:1Δ9 и 18:1Δ11 хорошо разделяются при газо-жидкостной хроматографии, поэтому появление 18:1Δ9 всегда хорошо заметно на хроматограммах. В случае трансформированных клеток E. coli ЖК состав смещен в сторону ненасыщенных ЖК, в то время как в контроле преобладают насыщенные ЖК (таблица, рис. 2). Данные показывают, что десатураза Cyanobacterium sp. IPPAS B-1200 способна работать на С14, С16 и даже С18 субстратах.

Таким образом, Δ9-десатураза цианобактерии Cyanobacterium sp. IPPAS B-1200, экспрессированная в клетках E. coli, проявляет активность в отношении субстратов С14:0, С16:0 и С18:0, с образованием мононенасыщенных ЖК с олефиновыми связями в положении Δ9: 14:1Δ9, 16:1Δ9 и 18:1Δ9. Это свидетельствует о том, что длина цепи ЖК у Cyanobacterium sp. IPPAS B-1200 определяется активностью синтазы ЖК, а десатурация в положении Δ9 происходит неспецифично по отношению к длине цепи ЖК и определяется наличием субстратов – соответствующих насыщенных ЖК.

Эти данные согласуются с результатами другой нашей работы, связанной с изучением специфичности одной из Δ9-десатураз прохлорофита Prochlorothrix hollandica, который также способен синтезировать большие количества С14 насыщенных и мононенасыщенных ЖК. Десатураза P. hollandica также неспецифична по отношению к длине углеродной цепи и образует олефиновую связь в положении Δ9 на С14–С18 субстратах [30].

Работа поддержана грантом Российского научного фонда № 14-24-00020 (Лось Д.А.) и грантом Министерства образования и науки Республики Казахстан № 1582/GF4 (Заядан Б.К.).

 

СПИСОК ЛИТЕРАТУРЫ

  1. Georgianna D.R., Mayfield S.P. Exploiting diversity and synthetic biology for the production of algal biofuels // Nature. 2012. V. 488. P. 329–335. doi: 10.1038/nature11479.
  2. Sarsekeyeva F., Zayadan B.K., Usserbaeva A., Bedbenov V.S., Sinetova M.A., Los D.A. Cyanofuels – biofuels from cyanobacteria: reality and perspectives. Photosynth. Res. // 2015. V. 125. P. 329–340. doi: 10.1007/s11120-015-0103-3.
  3. Sarsekeyeva F.K., Usserbaeva A.A., Zayadan B.K., Mironov K.S., Sidorov R.A., Kozlova A.Yu., Kupriyanova E.V., Sinetova M.A., Los D.A. Isolation and characterization of a new cyanobacterial strain with a unique fatty acid composition // Adv. Microbiol. 2014. V. 4. P. 1033–1043. doi: 10.4236/aim.2014.415114.
  4. Polyphasic characterization of the thermotolerant cyanobacterium Desertifilum sp. strain IPPAS B-1220 // FEMS Microbiol. Lett. 2017. V. 364. P. fnx027.doi: 10.1093/femsle/fnx027.
  5. Polashock J.J., Chin C.K., Martin C.E. Expression of the yeast Δ-9 fatty acid desaturase in Nicotiana tabacum // Plant Physiol. 1992. V. 100. P. 894–901. doi: 10.1104/pp.100.2.894.
  6. Orlova I.V., Serebriiskaya T.S., Popov V., Merkulova N., Nosov A.M., Trunova T.I., Tsydendambaev V.D., Los D.A. Transformation of tobacco with a gene for the thermophilic acyl-lipid desaturase enhances the chilling tolerance of plants // Plant Cell Physiol. 2003. V. 44. P. 447–450. doi: 10.1093/pcp/pcg047.
  7. Liu X., Sheng J., Curtiss R. III. Fatty acid production in genetically modified cyanobacteria // Proc. Natl. Acad. Sci. U.S.A. 2011. V. 108. P. 6899–6904. doi: 10.1073/pnas.1103014108.
  8. Choi Y.J., Lee S.Y. Microbial production of short-chain alkanes // Nature. 2013. V. 502. P. 571–574. doi: 10.1038/nature12536.
  9. Лось Д.А. Десатуразы жирных кислот // М.: Научный Мир, 372 c.
  10. Amiri R.M., Yur'eva N.O., Shimshilashvili K.R., Goldenkova-Pavlova I.V., Pchelkin V.P., Kuznitsova E.I., Tsydendambaev V.D., Trunova T.I., Los D.A., Jouzani G.S., Nosov A.M. Expression of acyl-lipid Δ12-desaturase gene in prokaryotic and eukaryotic cells and its effect on cold stress tolerance of potato // J. Integr. Plant Biol. 2010. V. 52. P. 289–297. doi: 10.1111/j.1744-7909.2010.00890.x.
  11. Los D.A., Mironov K.S. Modes of fatty acid desaturation in cyanobacteria: an update // Life. 2015. V. 5. P. 554–567. doi: 10.3390/life5010554.
  12. Starikov A.Y., Usserbaeva A.A., Sinetova M.A., Sarsekeyeva F.K., Zayadan B.K., Ustinova V., Kupriyanova E.V., Los D.A., Mironov K.S. Draft genome sequence of Cyanobacterium sp. strain IPPAS B-1200 with a unique fatty acid composition // Genome Announc. 2016. V. 4. P. e01306–16. doi: 10.1128/genomeA.01306-16.
  13. Pereira F.L., Soares S.C., Dorella F.A., Leal C.A., Figueiredo H.C. Evaluating the efficacy of the new Ion PGM Hi-Q Sequencing Kit applied to bacterial genomes // Genomics. 2016. V. 107. P. 189–198. doi: 10.1016/j.ygeno.2016.03.004.
  14. Williams J.G.K. Construction of specific mutations in photosystem II photosynthetic reaction center by genetic engineering methods in Synechocystis 6803 // Meth. Enzymol. 1988. V. 167. P. 766–778. doi: 10.1016/0076-6879(88)67088-1.
  15. Maniatis T., Sambrook J., Fritsch E.F. Molecular cloning: a laboratory manual. – Cold spring harbor laboratory press, 1989. Ed. 2.
  16. Bankevich A., Nurk S., Antipov D., Gurevich A.A., Dvorkin M., Kulikov A.S., Lesin V.M., Nikolenko S.I., Pham S., Prjibelski A.D., Pyshkin A.V., Sirotkin A.V., Vyahhi N., Tesler G., Alekseyev M.A., Pevzner P.A. SPAdes: a new crossmark genome assembly algorithm and its applications to single-cell sequencing // J. Comput. Biol. 2012. V. 19. P. 455–477. doi:10.1089/cmb.2012.0021.
  17. Edgar R.C. MUSCLE: multiple sequence alignment with high accuracy and high throughput // Nucleic Acids Res. 2004. V. 32. P. 1792–1797. doi: 10.1093/nar/gkh340.
  18. McWilliam H., Li W., Uludag M., Squizzato S., Park Y.M., Buso N., Cowley A.P., Lopez R. Analysis tool web services from the EMBL-EBI // Nucleic Acids Res. 2013. V. 41. P. W597–W600. doi: 10.1093/nar/gkt376.
  19. Li H., Homer N. A survey of sequence alignment algorithms for next-generation sequencing // Brief Bioinform. 2010. V. 11. P. 473–483. doi: 10.1093/bib/bbq015.
  20. Laemmli U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4 // Nature. 1970. V. 227. P. 680–685.
  21. Gurevich A., Saveliev V., Vyahhi N., Tesler G. QUAST: quality assessment tool for genome assemblies // Bioinformatics. 2013. V. 29. P. 1072–1075. doi: 10.1093/bioinformatics/btt086.
  22. Wada H., Avelange-Macherel M.H., Murata N. The desA gene of the cyanobacterium Synechocystis sp. strain PCC6803 is the structural gene for delta 12 desaturase // J. Bacteriol. 1993. V. 175. P. 6056–6058. doi: 0.1128/jb.175.18.6056-6058.1993.
  23. Sakamoto T., Los D.A., Higashi S., Wada H., Nishida I., Ohmori M., Murata N. Cloning of ω3 desaturase from cyanobacteria and its use in altering the degree of membrane-lipid unsaturation // Plant Mol. Biol. 1994. V. 26. P. 249–263. doi: 10.1007/BF00039536.
  24. Tasaka Y., Gombos Z., Nishiyama Y., Mohanty P., Ohba T., Ohki K., Murata N. Targeted mutagenesis of acyl-lipid desaturases in Synechocystis: evidence for the important roles of polyunsaturated membrane lipids in growth, respiration and photosynthesis // EMBO J. 1996. V. 15. P. 6416–6425. PMCID: PMC452467.
  25. Chintalapati S., Prakash S., Gupta P., Ohtani S., Suzuki I., Sakamoto T., Murata N., Shivaji S. A novel Δ9 acyl-lipid desaturase, DesC2, from cyanobacteria acts on fatty acids esterified to the sn-2 position of glycerolipids // Biochem. J. 2006. V. 398. P. 207–214. doi: 10.1042/BJ20060039.
  26. Shih P.M., Wu D., Latifi A., Axen S.D., Fewer D.P., Talla E., Calteau A., Cai F., Tandeau de Marsac N., Rippka R., Herdman M., Sivonen K., Coursin T., Laurent T., Goodwin L., Nolan M., Davenport K.W., Han C.S., Rubin E.M., Eisen J.A., Woyke T., Gugger M., Kerfeld C.A. Improving the coverage of the cyanobacterial phylum using diversity-driven genome sequencing // Proc. Natl. Acad. Sci. U.S.A. 2013. V. 110. P. 1053–1058. doi: 10.1073/pnas.1217107110.
  27. Panpoom S., Los D.A., Murata N. Biochemical characterization of a ∆12 acyl-lipid desaturase after overexpression of the enzyme in Escherichia coli // Biochim. Biophys. Acta. 1996. V. 1390. P. 323–332. doi: 10.1016/S0005-2760(97)00190-2.
  28. Raetz C.R. Enzymology, genetics, and regulation of membrane phospholipid synthesis in Escherichia coli // Microbiol. Rev. 1978. V. 42. P. 614–659. PMCID: PMC281446.
  29. Feng Y., Cronan J.E. Escherichia coli unsaturated fatty acid synthesis complex transcription of the fabA gene and in vivo identification of the essential reaction catalyzed by FabB // J. Biol. Chem. 2009. V. 284. P. 29526–29535. doi: 10.1074/jbc.M109.023440.
  30. Стариков А.Ю., Усербаева А.А., Лапина С.С., Миронов К.С., Маслова И.П., Пчёлкин В.П., Заядан Б.К., Синетова М.А., Лось Д.А. Субстратная специфичность ацил-липидной ∆9-десатуразы из цианобактерии Prochlorothrix hollandica – продуцента миристолеиновой кислоты // Физиология растений. 2017. Т. 64. С. 295–300. doi: 10.1134/S1021443717040148.

Подписи к рисункам
Рис. 1. Функциональные группы десатураз различных цианобактерий. Древо было построено на основании выравнивания аминокислотных последовательностей десатураз ЖК. Были использованы гены десатураз следующих организмов: 1200 – Cyanobacterium sp. IPPAS B-1200; 6803 – Synechocystis sp. PCC 6803; 7002 – Synechococcus sp. PCC 7002; 7120 – Nostoc sp. PCC 7120; 51142 – Cyanothece sp. ATCC 51142; 29133 – Nostoc punctiforme ATCC 29133; 7942 – Synechococcus elongatus PCC 7942; 7421 – Gloeobacter violaceus PCC 7421. В скобках приведены названия рамок считывания в соответствии с обозначениями генов в аннотированных геномах.
Рис. 2. Электрофоретическое разделение продуктов ПЦР-скрининга колоний после трансформации (а). М – маркеры ДНК; "+ контроль" – ПЦР-продукт, амплифицированный с геномной ДНК Cyanobacterium sp. IPPAS B-1200; "– контроль" – ПЦР-продукты из образцов, в которые вместо ДНК была добавлена среда культивирования. 1-6 – продукты амплификации с плазмидных ДНК. Электрофоретическое разделение продуктов рестрикции ферментами Nco I и Hind III в 1% агарозном геле (б). Краситель – бромистый этидий. М – маркеры, pTrc99а – вектор без вставки (7), pTrc99a::desC – вектор с клонированным фрагментом ДНК, полученным в результате амплификации (8).
Рис. 3. Качественные изменения ЖК-состава клеток Escherichia coli, экспрессирующих desC: а – клетки, трансформированные вектором pTrc99a; б – клетки, трансформированные вектором pTrc99a::desC. Ось ординат – величина сигнала, отн. ед. Жирные кислоты: 1 – лауриновая (12:0); 2 – миристиновая (14:0); 3 – миристоолеиновая (14:1Δ9); 4 – пальмитиновая (16:0); 5 – пальмитоолеиновая (16:1Δ9); 6 – цис-9,10-метилен гексадекановая кислота (Me-17:0); 7 – стеариновая (18:0); 8 – олеиновая (18:1Δ9); 9 – вакценовая (18:1Δ11); 10 – лактобацилловая (Me-19:0).